ID: 991330736

View in Genome Browser
Species Human (GRCh38)
Location 5:65489675-65489697
Sequence GACAGTTCTTGGCTGGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991330736_991330740 12 Left 991330736 5:65489675-65489697 CCAGTAACCAGCCAAGAACTGTC No data
Right 991330740 5:65489710-65489732 AGTAGTTATCTGCAGAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991330736 Original CRISPR GACAGTTCTTGGCTGGTTAC TGG (reversed) Intergenic
No off target data available for this crispr