ID: 991335404

View in Genome Browser
Species Human (GRCh38)
Location 5:65541206-65541228
Sequence TTAATTAAACCTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991335404 Original CRISPR TTAATTAAACCTGAGGAGGA GGG Intronic
901715398 1:11149587-11149609 ATTATCAAACCTGAGGAGGAGGG + Intronic
902827024 1:18982474-18982496 TTAGATACACCTCAGGAGGAAGG + Intergenic
902853460 1:19180812-19180834 TTACTTAGAGCTGAGAAGGAAGG - Intronic
903881201 1:26510748-26510770 TTAATTAAACTTAGTGAGGAAGG + Intergenic
907277126 1:53322934-53322956 TTTATTAAACCTGGGATGGAGGG + Intronic
907277348 1:53324183-53324205 TTTATTAAACCTGGGATGGAGGG - Intronic
908003279 1:59702779-59702801 TTAGTTATACCTGCTGAGGAGGG + Intronic
908683419 1:66687919-66687941 TTATTTAAACAAGAGGAGCAAGG + Intronic
908831679 1:68185256-68185278 TCAATCAATCCTAAGGAGGAGGG - Intronic
908900369 1:68949603-68949625 TTAATTAAGGCTCAGGGGGAAGG + Intergenic
908924288 1:69235064-69235086 GTAGTTACACCTGAGGAGGCAGG + Intergenic
910359915 1:86405196-86405218 CTAACTAAACCTGTGGAGGTAGG + Intergenic
910575921 1:88763639-88763661 TTCTTTAAGTCTGAGGAGGATGG - Intronic
910591153 1:88929082-88929104 TTAGTTTAACTTGAGCAGGACGG - Intergenic
910922038 1:92358738-92358760 TTTTTTAAAGCTGAGCAGGATGG - Intronic
912243630 1:107938302-107938324 TCAAGGAAAGCTGAGGAGGAAGG + Intronic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
915582923 1:156826119-156826141 TTAAAGACACCTGAGGAGAAAGG + Intronic
917086271 1:171308251-171308273 CCAATTACAGCTGAGGAGGAGGG - Intergenic
917280029 1:173371258-173371280 TCAATTACAACTGAGGAGGTGGG - Intergenic
917840041 1:178970128-178970150 TGGATTAAACCAGAGGAGGTGGG - Intergenic
919217994 1:194585533-194585555 CTATTTAAACCTGGGGAGAAGGG + Intergenic
919537900 1:198811162-198811184 ATAATAAAATCTGAAGAGGAGGG - Intergenic
920718729 1:208367216-208367238 GAAATTAAACCTGGGGAGTAGGG + Intergenic
920950567 1:210568399-210568421 TTAATCAAACCCAAGGAGGGAGG + Intronic
921084499 1:211776183-211776205 CTAATAAAAGCTGAGCAGGATGG + Intronic
922850149 1:228726083-228726105 ATAATAAAACATAAGGAGGAAGG - Intergenic
923464167 1:234233287-234233309 TTCATTAAAACTGATTAGGATGG + Intronic
924012358 1:239679455-239679477 TTATTTAAATCTGAACAGGAGGG + Intronic
924030226 1:239878865-239878887 CTAATTCAGCCTGAGGAGGAAGG + Intronic
1062924108 10:1301597-1301619 TTAATGAACCCTGAAGAGGGAGG - Intronic
1064257176 10:13752383-13752405 AAAATTAAACCTGAGAGGGAAGG + Intronic
1064780778 10:18835913-18835935 TAGATTTAACCTGAGAAGGAAGG - Intergenic
1066144138 10:32539019-32539041 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1068705953 10:60075683-60075705 TTAATTAAAGTTGAGGATGATGG + Exonic
1071039578 10:81290288-81290310 TTCCATAAAACTGAGGAGGAGGG + Intergenic
1076823448 10:132954068-132954090 TTAATAAAACCTGAGTTGGATGG - Intergenic
1077864671 11:6212152-6212174 TTGATTAAGACTGAGAAGGATGG - Intronic
1078450673 11:11438256-11438278 ATAATAAAACCAGAGGATGAAGG + Intronic
1078490268 11:11761840-11761862 TTAATCAAACCAGAGGAGGGGGG - Intergenic
1079811512 11:25003917-25003939 CCAATTAAAACTGAGGAGGTGGG + Intronic
1081214578 11:40380169-40380191 TCAATTAAACCTGAGGGAGTAGG + Intronic
1085160629 11:74340772-74340794 GTAATGAAACCTGAAGAGGAAGG + Intronic
1085556412 11:77426598-77426620 CTAATTGAAACTGAAGAGGAAGG - Intronic
1086015712 11:82164774-82164796 TTCCATAAACTTGAGGAGGAGGG + Intergenic
1086238701 11:84662933-84662955 TTAATTATAACTGAGTAGGCTGG - Intronic
1087036880 11:93765032-93765054 TTAATCAAACCTGAAGAGGTAGG - Intronic
1087155865 11:94902482-94902504 TTCATAAAACTTGAGGAGGAGGG + Intergenic
1088064183 11:105695788-105695810 TTACTTAAACCTGAAGATTATGG + Intronic
1088977166 11:114826096-114826118 GTAATAAAACCTGGGGTGGAGGG + Intergenic
1091050189 11:132360868-132360890 TCACTTAAACCTGGGGAAGAGGG - Intergenic
1091137541 11:133205422-133205444 TGAATTAAACCTGAAGAGGTGGG + Intronic
1092085863 12:5759296-5759318 TTAATTAAGCTTGTGGGGGAAGG + Intronic
1093096861 12:14981825-14981847 TTTATTAAATATGAGGAGGTGGG - Exonic
1094539613 12:31352254-31352276 CTAAATAGACCTGTGGAGGAAGG - Intergenic
1094775013 12:33716313-33716335 TAAATTAACCTTGTGGAGGAAGG + Intergenic
1097745830 12:63302292-63302314 TTAATTATCAGTGAGGAGGAAGG + Intergenic
1098712792 12:73786910-73786932 ATTATTAAGCCTAAGGAGGAAGG - Intergenic
1099672598 12:85713792-85713814 ATAAATAAAACTGAGAAGGAAGG - Intergenic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1101563903 12:105886854-105886876 TTACTTAAACCTGATGAGGTGGG + Intergenic
1101834166 12:108283481-108283503 TTAATGAAACCTGGGGAGGGTGG - Intergenic
1102081398 12:110101126-110101148 TAAATAAAACCTGAAGAGGAGGG - Intergenic
1102382496 12:112479375-112479397 TAAATTAAACCTAAGGCAGATGG + Intronic
1102663925 12:114553931-114553953 ATTATTGAACCCGAGGAGGAGGG - Intergenic
1103170254 12:118812184-118812206 TCCATTCAATCTGAGGAGGATGG + Intergenic
1104308071 12:127627827-127627849 TGAAGTGTACCTGAGGAGGAGGG - Intergenic
1105926393 13:25012511-25012533 TTAGTTGAATCTGAGGAGGATGG + Intergenic
1106414142 13:29531975-29531997 TTTAATAAACCTGAGAGGGAGGG - Intronic
1106867494 13:33982124-33982146 TGAATAAAACTTGAGAAGGAGGG - Intergenic
1107495971 13:40926147-40926169 TTATTGAAACCTTGGGAGGAAGG + Intergenic
1108239135 13:48444182-48444204 TTAATTGAACCTGAAGAGTGTGG - Intronic
1109230546 13:59751303-59751325 TTAATTAAACTTAAAGATGATGG - Intronic
1109352524 13:61202884-61202906 TTGATTAAATGTGAAGAGGAGGG + Intergenic
1109853263 13:68096446-68096468 TTAATTGTACCTGAGGGGAAAGG - Intergenic
1110130370 13:72001572-72001594 TTGGCTAAACCTGACGAGGAAGG - Intergenic
1111039734 13:82731046-82731068 TTGAATAAACCTGAGGACAATGG - Intergenic
1115860682 14:37682896-37682918 TTAAGTAAACCTTTGGAAGATGG + Intronic
1116014517 14:39390073-39390095 TTAATCAAATCTAAGCAGGAAGG - Intergenic
1118424204 14:65641182-65641204 TGAGTTAAACCTGTGGATGAAGG - Intronic
1118727907 14:68643466-68643488 TTAAGGAGACCAGAGGAGGATGG + Intronic
1120543193 14:85777149-85777171 TAAAACCAACCTGAGGAGGAAGG - Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1124194638 15:27611039-27611061 TTAATTCATCCTAAGGAGGTGGG + Intergenic
1124874525 15:33579432-33579454 TTGATTAATCCTAAGGTGGAAGG - Intronic
1125774946 15:42204021-42204043 TTAATTCCTCCTGAGAAGGAGGG + Intronic
1125845356 15:42847069-42847091 TTAATCAAACCCAAGGAGGGGGG + Intronic
1125923980 15:43546576-43546598 ATAATCAAAGCTGAGGATGATGG - Intronic
1126059712 15:44768492-44768514 TTATTTAAGCCTGTGGAGCATGG - Intergenic
1126071923 15:44873036-44873058 TGAATTACAACTGAGGAGGTGGG + Intergenic
1126165859 15:45653332-45653354 ATTATAGAACCTGAGGAGGATGG - Intronic
1127251715 15:57245569-57245591 TTAATGAACACTGAGTAGGAAGG + Intronic
1127978040 15:64013511-64013533 TTAAGAAAACATGAGGAGAAGGG + Intronic
1128899674 15:71408984-71409006 ATAAATAAACCTGAGGACAAGGG - Intronic
1130535438 15:84781998-84782020 TCCATTAAACCTGAGGAACAGGG - Intronic
1130833973 15:87631199-87631221 TGATATAAACCAGAGGAGGAAGG + Intergenic
1131389921 15:92039070-92039092 TTAATCCATCTTGAGGAGGACGG - Intronic
1131411367 15:92210679-92210701 CTAATTACAACTGAGGAGGTGGG - Intergenic
1132770437 16:1559227-1559249 TTTATTAAACCAGAGCAGGCAGG - Intronic
1134564251 16:15237293-15237315 TTTATTAAGCTTGAGGAGGTGGG - Intergenic
1134738243 16:16519406-16519428 TTTATTAAGCTTGAGGAGGTGGG + Intergenic
1134929256 16:18192757-18192779 TTTATTAAGCTTGAGGAGGTGGG - Intergenic
1137416859 16:48290538-48290560 TTAAGCAAACCTGAGGAGGGGGG - Intronic
1139208427 16:65052125-65052147 TTAATTAAATGTGAGGAAGGTGG - Intronic
1139382129 16:66539205-66539227 ATCATCAAACCTGGGGAGGAGGG - Intronic
1143718017 17:8789158-8789180 CTAAGTAAACCTGAGCATGATGG + Intergenic
1145065051 17:19756327-19756349 TTACTTAGACCTGGGGAGGAAGG - Intergenic
1145771073 17:27493634-27493656 TTATTTAAATCTGAGTTGGAAGG - Intronic
1147272247 17:39282515-39282537 AAAAATAAACTTGAGGAGGAGGG - Intronic
1148382994 17:47213566-47213588 TTGGTTGAACCTGGGGAGGAGGG + Intronic
1148549292 17:48541263-48541285 TTAAAGAAACCTAAGGAGGATGG + Intronic
1148975009 17:51519928-51519950 TTAATCAAGCCTAAGGAGGGGGG - Intergenic
1149856011 17:60083524-60083546 TTGGTTAAAGGTGAGGAGGAGGG - Intergenic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1152345143 17:79746936-79746958 TCCGTTTAACCTGAGGAGGATGG - Intergenic
1153008725 18:518818-518840 TTAATAAAACCTGAGGAAGAGGG + Intergenic
1155332785 18:24734718-24734740 TTATTTAAAGCAGAGGAGGGAGG + Intergenic
1155841088 18:30643539-30643561 TTAATAGAACCTAAGGAGGAGGG - Intergenic
1156955727 18:42960930-42960952 TAAAATAAACCTTAGGAGAAAGG - Intronic
1157494809 18:48149070-48149092 TTATTTAACCAGGAGGAGGAAGG + Intronic
1158429976 18:57376468-57376490 ATAATTCCACCTCAGGAGGAGGG - Intergenic
1158926182 18:62263884-62263906 GTAATTAAATATGAGGAGAAAGG + Intronic
1160545412 18:79649864-79649886 TAAATTAAACCTGAGCTGTATGG + Intergenic
1160630447 18:80243590-80243612 TTAATTATATCTGAGGGAGAAGG - Intronic
1166326839 19:42056294-42056316 TTTTTTAAACAGGAGGAGGAAGG + Intronic
1166846502 19:45731652-45731674 AAAATTAAGCCTTAGGAGGAAGG + Intergenic
1167859474 19:52271080-52271102 TTAATAAAATGTGAGGAGGCCGG - Intronic
1167958707 19:53089090-53089112 TTACTACAACCTGAGGAGGGGGG + Intronic
1167967073 19:53156687-53156709 TTAATAGAACCTGAGGTGGTGGG + Intronic
924960775 2:32614-32636 TTAAGTAAACATGGGGATGAGGG + Intergenic
926864580 2:17343446-17343468 TTAATTTAACTTGAACAGGATGG - Intergenic
930482678 2:51968804-51968826 TTTATTAAACACAAGGAGGAGGG + Intergenic
930718177 2:54612899-54612921 TTTGTTATACTTGAGGAGGAAGG + Intronic
931441097 2:62291132-62291154 TTAATTGAACCCAAGGAGGGGGG + Intergenic
931540634 2:63325623-63325645 TCAATTACAACTGAGGAGGTGGG - Intronic
931644821 2:64412296-64412318 TGAATTAAACATGAAGAGTAGGG - Intergenic
931797087 2:65721633-65721655 TTATTTCACCCTGAGGAGGAGGG - Intergenic
932784281 2:74586366-74586388 GTAATGAGAGCTGAGGAGGAGGG - Intronic
933187834 2:79298565-79298587 TTAATTAAAGAAGAGCAGGAAGG - Intronic
933386790 2:81621039-81621061 TTTATTAATACTGATGAGGAAGG + Intergenic
933918003 2:87016201-87016223 TTTATGAGACCAGAGGAGGAAGG - Intronic
934004992 2:87753713-87753735 TTTATGAGACCAGAGGAGGAAGG + Intronic
934025539 2:87999030-87999052 TTAATTAAACCCAAGGAGGTGGG + Intergenic
935767949 2:106387744-106387766 TTTATGAGACCAGAGGAGGAAGG + Intergenic
936859076 2:116994470-116994492 TTAATTGAGCTTGAGGAGGCGGG - Intergenic
936867182 2:117088029-117088051 TTAAATAAACCTGGGGCGGCTGG - Intergenic
936876319 2:117194009-117194031 TAACTTCAACCTGAGGAAGACGG - Intergenic
937127672 2:119484706-119484728 TGACTTCAATCTGAGGAGGAAGG - Intronic
939080202 2:137651107-137651129 TTAAATAAAATTGAAGAGGAGGG - Intronic
939400012 2:141680078-141680100 TTAGTTAAACCTGGGGAGGGTGG + Intronic
939719783 2:145634420-145634442 TTAATCAAACCCAAGGAGTAGGG - Intergenic
941243557 2:163070133-163070155 TCAATTACAACTGAGGAGGTGGG - Intergenic
943184702 2:184592815-184592837 TTAAGTAAAGATGGGGAGGAGGG - Intergenic
944514516 2:200499258-200499280 TTAATTAAATCGGGGCAGGAAGG + Intronic
945430547 2:209758612-209758634 TTCCAAAAACCTGAGGAGGAGGG + Intergenic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1170022418 20:11851015-11851037 TTAATTAACTCTGAGAAGCAGGG + Intergenic
1170122601 20:12926832-12926854 TTAAATAAACCTGAGAGGGGCGG - Intergenic
1172113813 20:32562441-32562463 TCATTTAAACCTGAGGTGGGCGG - Intronic
1172172698 20:32950465-32950487 TTAAATAAACCTGAGAGGGGCGG + Intronic
1181538235 22:23558111-23558133 TTAGTTAATCCTGAGGTGGGAGG - Intergenic
1181906921 22:26205425-26205447 TAAGGTAAACCTGAGGAAGAAGG - Intronic
1182929355 22:34158077-34158099 TTAAAAAACCCTGAGGAGGCCGG + Intergenic
1185152856 22:49176021-49176043 CTAAGTAACCCTGAGGAGAATGG + Intergenic
949419945 3:3855111-3855133 GTAATGACACCAGAGGAGGAAGG + Intronic
951251838 3:20402898-20402920 TGAATTAAAATTGAGGGGGAAGG + Intergenic
952227691 3:31395845-31395867 GTAATGAAACCTGAAGAGAAAGG - Intergenic
952246137 3:31594718-31594740 TTAATCAAACCTGTGAAGGGGGG - Intronic
952991692 3:38836230-38836252 TTAACTAAAGCAGAGAAGGATGG + Intergenic
954089459 3:48272900-48272922 TTGATTAAAGCTGACGAGAATGG - Intronic
955096845 3:55807099-55807121 TTAATTCAACATGTGAAGGACGG + Intronic
955891784 3:63657955-63657977 TCAGTTAAAGGTGAGGAGGATGG - Intronic
958843850 3:99241664-99241686 TTCATTAAAACTCAGGATGATGG + Intergenic
960245041 3:115390915-115390937 ATAATCAGACCTGAGGAGGTGGG - Intergenic
960249738 3:115438724-115438746 TTAGGTAAAGCTCAGGAGGATGG - Intergenic
960738266 3:120804177-120804199 TTAATAAAACCTGAGGAGGGGGG - Intergenic
962200645 3:133398829-133398851 TCAACTCAACCTCAGGAGGAAGG - Intergenic
962217728 3:133537147-133537169 TTACATAAATCTGATGAGGAAGG - Intergenic
962832954 3:139160137-139160159 TTACTTAAACCTGTGCAGGATGG - Intronic
963261300 3:143193815-143193837 ATGATCAAAGCTGAGGAGGAGGG - Intergenic
964113221 3:153108462-153108484 TTAATTAAACCTGATAAGTAGGG + Intergenic
964239984 3:154580992-154581014 TTAATTGAACCTAAGGTGGGGGG + Intergenic
966559396 3:181302658-181302680 CTAATTAAACCTAAGTAGTAAGG + Intergenic
966962485 3:184954043-184954065 TTAATGGAACCTGCGGAGGAGGG - Intronic
967129174 3:186454835-186454857 ATAAGTAAAACTGAGGAGAAGGG - Intergenic
967302943 3:188034282-188034304 TCAATTAAACCTGAAGATGAGGG - Intergenic
970724200 4:19024572-19024594 TTTATTAAACCTCATCAGGATGG - Intergenic
971708239 4:30076567-30076589 TTCCATAAAACTGAGGAGGAGGG - Intergenic
974528690 4:63079460-63079482 TAACTTCAACCAGAGGAGGAAGG - Intergenic
975406311 4:73994589-73994611 TTAATTAAAACCGAGCAGGGTGG + Intergenic
975747677 4:77490827-77490849 TTAATTAGACTTGAAGAGCAGGG - Intergenic
976298534 4:83496053-83496075 TTAAATAAACCTGAGAAGGGCGG + Intronic
976878233 4:89884274-89884296 ATAAGTAAACTTGAGGAGGATGG + Intronic
977846132 4:101769640-101769662 TTATAAAAACTTGAGGAGGAGGG - Intronic
977921494 4:102648881-102648903 TTAACTACACTTGTGGAGGAGGG - Intronic
978880807 4:113700497-113700519 CTATTTAAAGCTAAGGAGGAGGG - Intronic
979041451 4:115802470-115802492 ATAATTAAACCTTTGGAAGAAGG - Intergenic
979348180 4:119613776-119613798 TTATTTAAACCTGGTGAGGCAGG + Intronic
979742217 4:124166177-124166199 TTAATAAAGGCTGAGGAAGATGG - Intergenic
980635678 4:135498791-135498813 ATGATTAAACCTGGTGAGGAAGG - Intergenic
985986559 5:3521367-3521389 TTCAATAAAGCTGAGGAGAAGGG + Intergenic
987971272 5:24947692-24947714 TTAATTGATCCTCAGGATGAAGG - Intergenic
988903205 5:35756011-35756033 GAAAATAAACCTGAGGAGAAGGG - Intronic
989809216 5:45652504-45652526 TTAGTTAAACCTGTGGAGGTTGG - Intronic
989955845 5:50358764-50358786 TTAATTAAACCTAAGGGGAAAGG - Intergenic
990109196 5:52303258-52303280 TTGAGTATACCTGAGTAGGAAGG + Intergenic
991335404 5:65541206-65541228 TTAATTAAACCTGAGGAGGAGGG + Intronic
991358698 5:65797317-65797339 TTAATTAAACGTGAAAGGGATGG + Intronic
992195820 5:74337842-74337864 TTAATTCTAGCTGAAGAGGAAGG - Intergenic
993292237 5:86088538-86088560 TTAAATAAACCTGATGTGGGAGG - Intergenic
995190973 5:109319113-109319135 GTAATTAGCTCTGAGGAGGAAGG - Intergenic
996004603 5:118405327-118405349 TTGATTGAACCTGGGGAGCAGGG - Intergenic
996642702 5:125776512-125776534 TTAATCAAACCCGAAGAGGCGGG - Intergenic
1000098912 5:157995496-157995518 TAAATCAATACTGAGGAGGAAGG + Intergenic
1000844395 5:166261159-166261181 TTACTTCAACCTGAGAAGCATGG + Intergenic
1003166437 6:3683087-3683109 TCAAATAATCCTGACGAGGAAGG - Intergenic
1004097471 6:12572024-12572046 TTATTGAAACCTGAGAAGAATGG + Intergenic
1005880359 6:30053422-30053444 TTAAAAAAAACTGAAGAGGAAGG + Intergenic
1006187812 6:32190579-32190601 TTAATTAAAACCGAAGAGGGGGG + Intergenic
1007543355 6:42670887-42670909 TTAAATAAACTTCAGGAGGCCGG + Intronic
1007741967 6:44017125-44017147 TTAATTGAACCTGAGGAGAGGGG + Intergenic
1008495338 6:52127374-52127396 TTAATGAAAACTGAGGAGATTGG + Intergenic
1010005345 6:70989965-70989987 TGAAAAAAACCTGAGGATGAAGG + Intergenic
1011291547 6:85782027-85782049 TTAATCAAACCTGAGGAGGGGGG - Intergenic
1012079908 6:94743346-94743368 AAAATTAAACCTGAGAAGGAAGG - Intergenic
1013871083 6:114760889-114760911 TTAAATAAAACTTAGGAGGCTGG + Intergenic
1014523005 6:122468108-122468130 TTAATTAAACCTGGGAACTAGGG + Intronic
1015515418 6:134078411-134078433 ATAATTGAACCTGAGGAGGGGGG - Intergenic
1015683517 6:135834206-135834228 TAAAGAAAACCTAAGGAGGACGG - Intergenic
1016675811 6:146766475-146766497 TAAATTAAACCTGGGGGTGAGGG + Intronic
1017314386 6:153013536-153013558 TTAGTTAAACTTAATGAGGAAGG + Intronic
1018128789 6:160707885-160707907 TTTATAAGACCAGAGGAGGAAGG + Intronic
1018132345 6:160744194-160744216 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1021029267 7:15709733-15709755 TCAAGTAAACCTGAGAAGCAGGG - Intergenic
1021956564 7:25830846-25830868 ATTATTAAACTTGAGGAGCACGG + Intergenic
1022311567 7:29200973-29200995 TTAATTATAAATGAGGAGAAAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023137898 7:37071591-37071613 TTAATTAAACCTGGGGAGTGGGG - Intronic
1023205467 7:37745040-37745062 TTAAATGAAGTTGAGGAGGAAGG - Intronic
1024864088 7:53882868-53882890 TAAAATAAACCTAAGGAGGATGG + Intergenic
1026326181 7:69312773-69312795 ATAATGAAACAAGAGGAGGATGG - Intergenic
1027501909 7:78962687-78962709 TTAATAAAACCTGATTAGGGAGG + Intronic
1027517741 7:79163641-79163663 TTAAATAACCCTGATAAGGAAGG + Intronic
1027552396 7:79615537-79615559 TTAAGTTAACCTGAGAAGGGTGG - Intergenic
1028235941 7:88361551-88361573 ATGATGAAACCTGAGGAGGGTGG + Intergenic
1028908339 7:96179264-96179286 TAGATTAAACCTCAGTAGGAGGG - Intronic
1029031352 7:97470808-97470830 TTAAATAAACTTGAGTATGAAGG + Intergenic
1030571629 7:111232922-111232944 TTAATGCTGCCTGAGGAGGAAGG - Intronic
1031692229 7:124802840-124802862 TTAAATAATACTGAGGAGAATGG - Intergenic
1032374888 7:131403563-131403585 ATAATTAAACTTAGGGAGGAAGG - Intronic
1033661565 7:143406521-143406543 CTAATTGAACCCGAGGAGGAGGG + Intronic
1033738063 7:144244319-144244341 TTAATTGAGCCTAAGGAGGGGGG + Intergenic
1034008634 7:147503898-147503920 TTAAAGAACCCTGAGGAGAAGGG + Intronic
1035877982 8:3212292-3212314 TTAATTAAACATGACTAGAAAGG + Intronic
1036637252 8:10559782-10559804 TTCATTAGCCCTGAGGAGAAGGG - Intergenic
1036934243 8:12985758-12985780 TAAATGAAACTAGAGGAGGAAGG - Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1040424632 8:47273254-47273276 TTAATCGAACCTAAGGAGGAAGG - Intronic
1040667756 8:49653613-49653635 CTAATTACAACTGAGGAGGTGGG + Intergenic
1040796700 8:51295884-51295906 TGAATTACAACTGAGGAGGTGGG + Intergenic
1042269697 8:66942487-66942509 TTAATCAAACTTGAGGAAGGGGG - Intergenic
1042666435 8:71211784-71211806 TTAATTCAACCTGAAAATGAAGG - Intronic
1042923381 8:73941630-73941652 TTAAAAAAACCTGAGGGTGAAGG + Intronic
1044707377 8:95021795-95021817 ATTATCAAACCTGAGGAGGAAGG + Intronic
1045178623 8:99755471-99755493 ATAATAAACCCTGAGGAGGCTGG + Intronic
1045734798 8:105282207-105282229 TTATGTAAACCTTAGGAGGAAGG - Intronic
1046013376 8:108576871-108576893 TATTTTAAAACTGAGGAGGATGG + Intergenic
1046546709 8:115661704-115661726 TTAAGTAAACCTTAAGGGGAGGG + Intronic
1052340854 9:27362895-27362917 TTAAATAAACCTCAGAAGGTGGG + Intronic
1052446404 9:28566968-28566990 TTACTTAAAGCTGAAGATGAAGG - Intronic
1052968798 9:34363740-34363762 TTACATAATCCTGAGCAGGATGG - Intergenic
1053337811 9:37292508-37292530 TAAATTTAACCTGAGGATGGAGG + Intronic
1053386614 9:37696176-37696198 TAAATTTAACCTGATGAAGAAGG - Intronic
1055606350 9:77974769-77974791 TTAATTAAACCTTAGAACGTGGG - Intronic
1057554357 9:96075796-96075818 TTATTTAAACAAGAGGAGGAGGG + Intergenic
1059511731 9:114854692-114854714 ATAATCAAACCTGAGGAGAGGGG - Intergenic
1060911252 9:127352839-127352861 TTAATTAAAATTTAGGAGCAAGG - Intronic
1061048958 9:128182918-128182940 TTAATTAAGACTGTGGAGGCCGG - Intronic
1061499919 9:130995908-130995930 TTAATTAAATCTGGGGAGATCGG - Intergenic
1061705907 9:132452833-132452855 TTTATTGGACCTGAGCAGGAGGG + Intronic
1061857702 9:133451556-133451578 TTATTTAAAACTAAGGAGGCTGG - Intronic
1186194530 X:7097883-7097905 CTAAGTCAGCCTGAGGAGGAAGG + Intronic
1187364066 X:18652054-18652076 TGAAGTATGCCTGAGGAGGAGGG - Intronic
1188800538 X:34524488-34524510 TTTATCAAACTTGAGGAGGGGGG + Intergenic
1188848704 X:35105632-35105654 TTAATTAACCATGATCAGGAAGG + Intergenic
1189942624 X:46141320-46141342 ATGATTAAACTTGATGAGGAAGG + Intergenic
1193753911 X:85382840-85382862 TTAATTAAATCCAAGGAGGGGGG - Intergenic
1194219420 X:91172835-91172857 TTCCATAAAACTGAGGAGGAGGG - Intergenic
1196507238 X:116461934-116461956 TTAATTAACCCAGAAGAAGAGGG + Exonic
1197494167 X:127156662-127156684 TAAATAAAACCTGAGGAAGAGGG - Intergenic
1197584239 X:128325101-128325123 TTTATTAAACCTAAGAAGTATGG + Intergenic
1197925815 X:131646227-131646249 ATAATTGAAACTGAGGAGTAAGG + Intergenic
1199098671 X:143771627-143771649 ACAAAAAAACCTGAGGAGGAGGG + Intergenic
1200555933 Y:4636597-4636619 TTCCATAAAACTGAGGAGGAGGG - Intergenic
1201407409 Y:13662962-13662984 TCAATTACAACTGAGGAGGTTGG + Intergenic