ID: 991341457

View in Genome Browser
Species Human (GRCh38)
Location 5:65615190-65615212
Sequence ATAGAGAAATAGGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35337
Summary {0: 1, 1: 5, 2: 142, 3: 2285, 4: 32904}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991341457 Original CRISPR ATAGAGAAATAGGCTGGGCA CGG (reversed) Intronic
Too many off-targets to display for this crispr