ID: 991341510

View in Genome Browser
Species Human (GRCh38)
Location 5:65615915-65615937
Sequence GTTCCCCACTGACCACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991341510 Original CRISPR GTTCCCCACTGACCACAAAC AGG Intronic
900191592 1:1354498-1354520 GTTCCCCGCAGACCCCACACTGG - Exonic
902536949 1:17124790-17124812 GTTCCCAACAGACCACAGACTGG + Intergenic
903814981 1:26058301-26058323 CTTCCCCACTGACCACCCATGGG - Intronic
905688917 1:39928411-39928433 GTTCCTAACAGACCACAGACCGG - Intergenic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
911053966 1:93695179-93695201 GGTCCAGACTGACAACAAACTGG - Intronic
912857906 1:113188121-113188143 GTTCCCCACTACCCAGAAACAGG + Intergenic
914335776 1:146713962-146713984 GTTCCTAACAGGCCACAAACTGG - Intergenic
916511217 1:165473880-165473902 ATTCCCCACTCAGAACAAACGGG + Intergenic
922031171 1:221800974-221800996 GTTCCTAACAGACCACAGACAGG - Intergenic
1064429272 10:15257269-15257291 GTGCCCCACTGCCCTCACACAGG - Intronic
1066214152 10:33269610-33269632 GTTCCTAACAGACCACAAACTGG - Intronic
1069691021 10:70352663-70352685 ACTCCCCACTGCCCACAAACAGG - Intronic
1071985008 10:91041408-91041430 TGTCCCAACTGACCCCAAACTGG - Intergenic
1073369130 10:102970774-102970796 GTTTCCCAGTAACAACAAACTGG - Intronic
1075626510 10:123967731-123967753 GTTCCCCACTGGCCCCTACCGGG - Intergenic
1076027703 10:127129970-127129992 GTGCCCCCCTGACCAGAGACAGG - Intronic
1076888050 10:133271551-133271573 GCTCCCCACGCTCCACAAACAGG + Exonic
1078097278 11:8307756-8307778 GTTCCTAACAGACCACAGACTGG - Intergenic
1078174083 11:8955743-8955765 GTTCCTAACAGACCACAGACTGG + Intronic
1079870428 11:25792300-25792322 GTTCCCAACAGGCCACAGACTGG - Intergenic
1080838472 11:35962502-35962524 GTTCCACACTGACTTCAAAAGGG + Intronic
1081294180 11:41365049-41365071 GTTCCTAACAGGCCACAAACTGG - Intronic
1082125135 11:48423532-48423554 GTTCCCCACTGAGCATGTACAGG + Intergenic
1082250900 11:49979112-49979134 GTTCCCCACTGAGCATGTACAGG - Intergenic
1082558797 11:54594798-54594820 GTTCCCCACTGAGCATGTACAGG + Intergenic
1082740837 11:56909236-56909258 GTTCCTAACAGACCACAGACTGG + Intergenic
1083119468 11:60497105-60497127 GTTTCCAACAGACCACAGACAGG + Intronic
1084093787 11:66896747-66896769 GATCCCCACGGACCACAATGTGG + Intronic
1084968596 11:72757287-72757309 GTTCCCCACTGGACACAACGAGG + Intronic
1086341305 11:85851615-85851637 GCTTCACACTGACCACCAACTGG + Intergenic
1086393876 11:86394063-86394085 GTTTCCCACTTTCCACACACAGG - Intronic
1090058307 11:123442094-123442116 GTTCTCCAGTGGACACAAACTGG + Intergenic
1090645758 11:128765467-128765489 TATCCCCACCGTCCACAAACGGG + Intronic
1093272222 12:17078139-17078161 GTTCCCCACTGCACAGAACCTGG - Intergenic
1093963291 12:25299069-25299091 GTTCCCCACTGACCAAATGCAGG - Intergenic
1095967108 12:47876119-47876141 GTTCACAAATGACCACAAAGGGG + Intronic
1098308376 12:69123732-69123754 GTACCCCACTGACCAACAACTGG - Intergenic
1098590223 12:72202243-72202265 GCTCCCCACTGGCCAGAAACAGG - Intronic
1100125513 12:91420040-91420062 GTTTCCCTCTGACCACACAATGG + Intergenic
1100547822 12:95620197-95620219 GTTCCTAACAGACCACAGACCGG + Intergenic
1100567857 12:95815400-95815422 TCTCTCCACTGACCACAAGCCGG + Intronic
1100986123 12:100203199-100203221 GTTCCCAACAGACCACAGACAGG + Intronic
1101014423 12:100484815-100484837 GTTCCCCATTGACCACAGTTAGG + Intronic
1101557477 12:105823911-105823933 GTTCACCACTGTCTACAAAATGG + Intergenic
1103161351 12:118731899-118731921 GTTCCTAACAGACCACAGACTGG - Intergenic
1105064254 12:133182933-133182955 GTTCCTAACAGACCACAGACTGG - Intronic
1107749568 13:43550189-43550211 GTTCCTAACAGGCCACAAACTGG + Intronic
1112500648 13:99940550-99940572 GTTTCCCACTGTACACAAAGAGG + Intergenic
1112594396 13:100794696-100794718 GTTCCCAACAGGCCAAAAACTGG - Intergenic
1122036027 14:98949990-98950012 GTTCCCCAGTGAGCACACAGAGG - Intergenic
1122117451 14:99534999-99535021 CTTCCCCACAGCCCACAAAGGGG + Intronic
1202894242 14_KI270722v1_random:188910-188932 GTTCCTCACAGGCCACAGACTGG - Intergenic
1124403913 15:29377294-29377316 GTTTCCCAGGGACCACAAAATGG - Intronic
1125643539 15:41251495-41251517 GTTCCTAACTGGCCACAGACTGG - Intronic
1128780984 15:70358528-70358550 ATTCCCCACTCAGCACAAAATGG - Intergenic
1135105196 16:19643517-19643539 GTTCCCCAATGCCCACAGGCTGG - Intronic
1137383864 16:48023554-48023576 GTTCCCAAATGACCACAATTTGG - Intergenic
1137396964 16:48123025-48123047 CTTCCCCAGTGACCACAGCCAGG + Intronic
1138313697 16:56050145-56050167 GTTCCTAACAGGCCACAAACCGG - Intergenic
1139997848 16:70997266-70997288 GTTCCTAACAGGCCACAAACTGG + Intronic
1140672624 16:77293898-77293920 GTTCCTTACAGACCACAAACAGG + Intronic
1142433002 16:90040650-90040672 GTTCCCAACTGGCCCGAAACTGG - Intronic
1144310858 17:14013312-14013334 GTTCCCCACAGGCCACAAACTGG - Intergenic
1151331622 17:73413048-73413070 GTTCCTAACAGACCACAGACTGG - Intronic
1152684333 17:81686770-81686792 GTTCCCCACCGGCCACTGACGGG + Intronic
1152684365 17:81686874-81686896 GTTCCCCACCGGCCACTGACGGG + Intronic
1154322489 18:13366399-13366421 TTTCCCCAAAGACCACTAACAGG + Intronic
1155394498 18:25372749-25372771 CTTTCCCACTGCCCACCAACCGG + Intergenic
1156051247 18:32937036-32937058 GTTCCCCAATGCCTACAAAAGGG - Intergenic
1156762980 18:40615753-40615775 GTTCCCCCCAGGCCACAAATGGG - Intergenic
1157209947 18:45733759-45733781 GTTCCCAACAGGCCACAGACAGG - Intronic
1161831804 19:6611255-6611277 GTTACTAACTGACCACAAAATGG - Intergenic
1162054912 19:8056628-8056650 GTGCCCCACTCACCAGCAACTGG - Intronic
1166007647 19:39918165-39918187 GCTCCCCACCGACCACACACAGG + Exonic
1168467932 19:56618991-56619013 GGTCCCCACTGACAAAAAGCCGG - Intronic
925282536 2:2694825-2694847 ATTCCCCACTGACCACCCGCAGG - Intergenic
927504163 2:23602478-23602500 GTTCCCCACTGGCCTCACACAGG - Intronic
928822534 2:35378916-35378938 GGTCCCCACTGGCCAAAAATGGG - Intergenic
929446937 2:42009237-42009259 CTGCCCCACTGACCCCAAAAAGG - Intergenic
929951302 2:46411615-46411637 GTTCCCCACTGCCCAGCAAAAGG - Intergenic
931011142 2:57915758-57915780 GTTCCTAACAGGCCACAAACCGG - Intronic
933647985 2:84827756-84827778 ATCCCCCTCTGACCACAGACGGG - Intronic
934691640 2:96365206-96365228 GTTCCCCCCTTTCCACATACAGG - Intronic
935002372 2:99031651-99031673 GTTCCTAACAGACCACAGACTGG - Intronic
935131990 2:100267559-100267581 GTGCCCCACGGACCACAGCCTGG + Intergenic
937412570 2:121689343-121689365 GTTCACCACTGACTCCAAAATGG + Intergenic
940190810 2:151038127-151038149 GTTCTCCACTGGACACCAACTGG - Intronic
940986821 2:160059248-160059270 GTTCCTAACAGGCCACAAACTGG + Intronic
944318716 2:198311271-198311293 GTTCCTAACTGGCCACACACTGG + Intronic
946091075 2:217224483-217224505 GTTCCTCACTGACAACTAGCAGG - Intergenic
1169130056 20:3161941-3161963 GTTCCCTCCTTACCACAAAGTGG - Intergenic
1169810077 20:9600980-9601002 GTCCCACTCTGACCCCAAACAGG + Intronic
1170485363 20:16810298-16810320 CTTCCCCACTGACCACAGGCTGG - Intergenic
1172239086 20:33400208-33400230 GTTCCTCACAGGCCACAGACAGG + Intronic
1173282643 20:41643167-41643189 ATTCCCCACTGAACTCAAGCAGG + Intergenic
1174986666 20:55461621-55461643 GTTCCTAACAGGCCACAAACTGG - Intergenic
1175151014 20:56934302-56934324 GTTCCTCACTGAGGCCAAACAGG - Intergenic
1178495037 21:33079155-33079177 TTTATCCACTCACCACAAACCGG - Intergenic
1184119515 22:42441010-42441032 TTTCCCCACTGCCCACAGCCTGG + Intergenic
1184946705 22:47808982-47809004 GGTCCACACTGACCAACAACAGG + Intergenic
952539845 3:34356464-34356486 TTTCTCCACTGGCCTCAAACAGG + Intergenic
955251542 3:57287773-57287795 GTTCCCAACTGACCAGACATGGG - Intronic
955740805 3:62089639-62089661 GCTCCCAACAGACCCCAAACGGG - Intronic
956390590 3:68769059-68769081 GTTCCTAACAGGCCACAAACTGG - Intronic
957150949 3:76485479-76485501 GTTCCTAACAGACCGCAAACTGG + Intronic
959040846 3:101422004-101422026 GTTCCTAACAGACCACAGACTGG - Intronic
959775910 3:110162784-110162806 GTTCCTAACAGGCCACAAACGGG - Intergenic
960672505 3:120166938-120166960 GTTCCCCAAAGACCAGAAATTGG + Exonic
961195033 3:124994313-124994335 GTTCCTAACAGACCACAAACTGG + Intronic
962658437 3:137574020-137574042 ATTCTCCACAGACCACAACCAGG + Intergenic
963047293 3:141112114-141112136 GATCCCCACTGATCACTCACTGG + Intronic
965214040 3:165837194-165837216 GTTCCCCACAGAGCACCAAAGGG + Intronic
967251081 3:187539409-187539431 GACCCCCATTGACCACAAATTGG + Intergenic
967503531 3:190227206-190227228 GCTCCCCACAGACCAGAAGCAGG + Intergenic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
969624744 4:8296732-8296754 GTTCCCCACAGTCCACAGAGGGG - Intronic
970500945 4:16676575-16676597 ATTCACCACTGACTACAAACAGG + Intronic
970657508 4:18247733-18247755 GTTCTCCAAAAACCACAAACTGG - Intergenic
971301518 4:25446088-25446110 TTTCCACACTGAACACCAACAGG - Intergenic
971755244 4:30699342-30699364 GTTCCTAACAGGCCACAAACTGG + Intergenic
976206921 4:82631383-82631405 GCTGGCCACTGACCGCAAACGGG - Exonic
976482864 4:85564846-85564868 GTTCCTAACTGGCCACAGACTGG + Intronic
983906896 4:173192693-173192715 ATTAACCACTGAACACAAACAGG - Intronic
984376826 4:178942132-178942154 GTTCCTCACAGGCCACCAACCGG - Intergenic
987110885 5:14685420-14685442 GTTTTCCACTAAGCACAAACTGG - Intronic
987137937 5:14917265-14917287 GTTCCACACTGAACAGACACTGG - Intergenic
987230628 5:15890137-15890159 GTTCCTAACTGGCCACAGACCGG - Intronic
988178403 5:27757721-27757743 TTTCCACAATAACCACAAACTGG + Intergenic
990972175 5:61520064-61520086 GTTCCTAACAGACCACAGACTGG + Intronic
991341510 5:65615915-65615937 GTTCCCCACTGACCACAAACAGG + Intronic
992787929 5:80187472-80187494 GTTGTCCACTGACCAATAACAGG - Intronic
993696217 5:91065113-91065135 GTTCACCATTTATCACAAACTGG - Intronic
995208876 5:109514292-109514314 GTTCCCCACTGAACACTATGAGG - Intergenic
996568837 5:124910427-124910449 GTTCTCCACTGGACACCAACTGG - Intergenic
996585131 5:125079140-125079162 GTTCCTAACCGGCCACAAACCGG - Intergenic
998926707 5:147134701-147134723 GTTCCTAACAGACCACAGACTGG + Intergenic
999502873 5:152164393-152164415 GTTCCTAACAGACCACAACCTGG - Intergenic
999587234 5:153103423-153103445 GTTCCTAACAGGCCACAAACTGG - Intergenic
1002195566 5:177499028-177499050 GTTCCTAACAGGCCACAAACGGG - Intergenic
1002323682 5:178390994-178391016 GTTCCTAACAGGCCACAAACTGG - Intronic
1003141761 6:3477721-3477743 GTTCCTAACAGACCACAGACTGG + Intergenic
1004694516 6:18021180-18021202 GTTCCCCAACGGCCACAATCAGG - Intergenic
1006710074 6:36060667-36060689 CTTCCCCACAGAACACAAAGGGG + Intronic
1007334939 6:41149219-41149241 TTTCCCCACTGACGAGAGACAGG + Intergenic
1007631068 6:43274031-43274053 GGCCCCCACTCACCACAAAAAGG - Intronic
1007895366 6:45350872-45350894 GTTCCCAACAGGCCACGAACTGG - Intronic
1008124790 6:47656087-47656109 ATGCCCCACTGACCACAAGGAGG + Intergenic
1010776632 6:79894055-79894077 GTTCCTAACAGGCCACAAACCGG - Intergenic
1015765915 6:136716298-136716320 GTTTCCCACTCTCCACAATCTGG + Intronic
1016631619 6:146239998-146240020 GTTCCTCACTGTCCATAAAATGG + Intronic
1018097021 6:160397366-160397388 GTTCCTAACAGGCCACAAACTGG + Intronic
1021784946 7:24142291-24142313 GTTCCCCAGTGCCCCCACACTGG - Intergenic
1021887028 7:25149194-25149216 GTTGCCCACTAACCAGAAAGGGG - Intronic
1021988559 7:26120586-26120608 TTTTCACACTGACCAAAAACTGG + Intergenic
1022032540 7:26505439-26505461 GTTCCAAACTGACAACAAATGGG + Intergenic
1023151485 7:37205117-37205139 CTTCCCCACTTATCACAGACGGG + Intronic
1023277523 7:38535876-38535898 GTTCCTCACCGGCCACAAACTGG + Intronic
1027195882 7:76029943-76029965 GTTCCTAACAGACCACAGACTGG + Intronic
1027712713 7:81626219-81626241 TTTCCCCAGTGATAACAAACTGG - Intergenic
1029268064 7:99358114-99358136 CCTGCCCACTGACGACAAACTGG - Intronic
1030170568 7:106598787-106598809 GCTCCCCACTCACCACCAAAAGG + Intergenic
1031826747 7:126575105-126575127 GTTCCTAACAGGCCACAAACCGG - Intronic
1032492358 7:132333210-132333232 ATTCCCCACTAGCCACACACAGG - Intronic
1036132751 8:6131697-6131719 GTTCCTAACAGGCCACAAACAGG + Intergenic
1036159700 8:6375693-6375715 GTTCCTAACAGGCCACAAACTGG - Intergenic
1037151264 8:15637983-15638005 GTTTCCCACTCCCCACAAAGTGG + Intronic
1038175500 8:25178642-25178664 TTTCTTAACTGACCACAAACAGG + Intergenic
1039682768 8:39760273-39760295 GTTTCCCACTGGCACCAAACTGG + Intronic
1043781305 8:84339250-84339272 GTTCCCAACAGGCCACAAACTGG - Intronic
1045217985 8:100167807-100167829 GGTCTACACTGACCACAAATGGG - Intronic
1045922962 8:107554143-107554165 TTTTCCCACTAATCACAAACAGG + Intergenic
1046988407 8:120417634-120417656 GGTGCCCACTGACCAAATACAGG - Intronic
1048316303 8:133365054-133365076 ATTCCCCTCTGATCACAAAGTGG - Intergenic
1048397711 8:134030470-134030492 CTGCCACAGTGACCACAAACTGG + Intergenic
1049362520 8:142219167-142219189 GTTCCCCTCTTAGCAGAAACAGG - Intronic
1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG + Exonic
1052181928 9:25539876-25539898 GCTCTCCACTGACCACACAGGGG - Intergenic
1052390417 9:27872564-27872586 GTTCCTAACAGGCCACAAACTGG + Intergenic
1052956913 9:34259794-34259816 GTTCCCTTCTGTCCACAAAAAGG + Intronic
1053025555 9:34725746-34725768 CTTCCCCACTTTCCCCAAACTGG - Exonic
1054708971 9:68491878-68491900 CTTCCCGACTAACCAGAAACAGG - Intronic
1056766042 9:89445355-89445377 TCTCACCAGTGACCACAAACTGG + Intronic
1057061854 9:92010933-92010955 TTTCACAACTGGCCACAAACAGG + Intergenic
1057579235 9:96271326-96271348 TTTGCCCACTGAGCACAAATGGG - Intronic
1058893616 9:109381855-109381877 GTTCCCCGCTGACTCCAAAGGGG + Intronic
1060173887 9:121482993-121483015 CTTCCCCACTGACCATACATAGG - Intergenic
1188999078 X:36923413-36923435 GCTCCCCACTGGCCAAAGACAGG + Intergenic
1189880212 X:45483181-45483203 GTTCCTAACAGGCCACAAACTGG + Intergenic
1190380858 X:49838602-49838624 GTGCCCCACTGACCACAAGATGG - Intergenic
1194665476 X:96673016-96673038 GTTGACCTCTGACCACACACAGG - Intergenic
1194945594 X:100063276-100063298 GTTCCTAACAGACCACAGACTGG - Intergenic
1197830127 X:130632769-130632791 GTTCCCCTCTGACTACAGCCAGG - Intronic
1198271076 X:135056416-135056438 GTTCCCAACAGGCCACAGACTGG + Intergenic