ID: 991342077

View in Genome Browser
Species Human (GRCh38)
Location 5:65622784-65622806
Sequence AATTCTGTGCTGTAAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991342075_991342077 -9 Left 991342075 5:65622770-65622792 CCTCCAATGTATCAAATTCTGTG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 991342077 5:65622784-65622806 AATTCTGTGCTGTAAGAAACTGG 0: 1
1: 0
2: 0
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991342077 Original CRISPR AATTCTGTGCTGTAAGAAAC TGG Intronic
905445307 1:38024743-38024765 ACTTTTGTGATGTAACAAACTGG - Exonic
906714273 1:47955348-47955370 TATTCTGTGCTGTAGACAACTGG - Intronic
907735769 1:57110346-57110368 AATGCTGTTCTGCAAGCAACCGG + Intronic
908335015 1:63113622-63113644 AAATCTGTCTTGTAAGGAACTGG - Intergenic
909327277 1:74366582-74366604 AGGTCTGTGCCTTAAGAAACAGG - Intronic
910458872 1:87426845-87426867 TACTCTGTGCTGAAAGACACAGG - Intergenic
915182087 1:154070800-154070822 CATTCTGCTATGTAAGAAACAGG + Intronic
917269867 1:173260689-173260711 AAGTCTGTTTTGTCAGAAACTGG - Intergenic
918447544 1:184630213-184630235 AAGCCTCTGCTGGAAGAAACAGG - Intergenic
921462219 1:215443019-215443041 AAGTCTGTTTTGTCAGAAACTGG + Intergenic
921641559 1:217560702-217560724 AATTCTTTGCTGTGGGAGACTGG + Intronic
921741492 1:218690641-218690663 GATTGTGTGCTGTATGAAAAAGG - Intergenic
922098510 1:222462725-222462747 ATTTCTGTACTGTAAGAAAAAGG - Intergenic
922524405 1:226288654-226288676 ATTTTTGTGCTGTTATAAACAGG - Intronic
922884906 1:229011888-229011910 CATTCTAAGATGTAAGAAACTGG - Intergenic
923005667 1:230047528-230047550 AACTCTGTTCTGTAAGAACTTGG - Intergenic
923429565 1:233906850-233906872 AATTATTTGCAGGAAGAAACAGG + Intronic
1064238738 10:13604931-13604953 AATTCTTTTTTGTAAGAAAAGGG - Intronic
1064718318 10:18200965-18200987 AACTCTGTGCAGTAAGAATTTGG + Intronic
1064719053 10:18209511-18209533 AATTCTGAGCTGTATTACACAGG + Intronic
1066037847 10:31511687-31511709 CATTCTTTGATGTAAGAAACTGG - Intronic
1067019382 10:42781857-42781879 AAAGCTGTGCAGTAAGAAAACGG + Intergenic
1067780481 10:49200073-49200095 AATTCTATACAGTAATAAACAGG + Intergenic
1069525952 10:69171395-69171417 AATGCTGCGCTGTAAGATAAAGG - Exonic
1071489067 10:86123682-86123704 AATTCCCTGCTGAAAGAAAGAGG + Intronic
1073497975 10:103911496-103911518 AATTCTTTACTTTCAGAAACAGG + Intronic
1073738195 10:106374476-106374498 AAGTGTCTGCTTTAAGAAACTGG + Intergenic
1081989565 11:47330504-47330526 AATTCTGTCCTGGAAAAACCTGG + Intergenic
1083365862 11:62141103-62141125 CAGTCTGTCCTGTAAGATACTGG + Intronic
1084866866 11:72065942-72065964 AATACTGTACTGTAAGAACCAGG + Intronic
1085327133 11:75614934-75614956 CATACTCTGTTGTAAGAAACAGG + Intronic
1088700309 11:112405673-112405695 AAGTCGGTGCTGTCAGAAAAAGG + Intergenic
1089681530 11:120121551-120121573 ATGTCTGTGATGGAAGAAACAGG - Intronic
1092779041 12:11968306-11968328 AATTCTGTGCTCTAAGCATCTGG + Intergenic
1093333062 12:17866691-17866713 AATTCTTTTCTGTAAAAAAAAGG - Intergenic
1095564880 12:43611435-43611457 AATTCTGTGATGAAAGTAATTGG - Intergenic
1095771149 12:45958939-45958961 AACACTGGTCTGTAAGAAACTGG - Intronic
1095818903 12:46455383-46455405 AAAGCTGTGCTGGAAGAAATTGG + Intergenic
1096157515 12:49348822-49348844 ACTTCTGTGCTGCGAGTAACCGG + Exonic
1096879703 12:54657858-54657880 AGTTTTGTGCTGGAAGAAACAGG - Intergenic
1097353485 12:58574918-58574940 AATTATTTTTTGTAAGAAACAGG - Intronic
1097977693 12:65706234-65706256 AATTCTGTGATTTAACTAACAGG - Intergenic
1099830602 12:87837839-87837861 AATTCTGTGATGAAAGTAAAGGG - Intergenic
1100018843 12:90045719-90045741 AATTCTTTGTTGTAAGGCACTGG - Intergenic
1102203308 12:111073217-111073239 TAATCTGTGCTGTAAGAAGTGGG - Intronic
1106172617 13:27301196-27301218 AAATGTGGGGTGTAAGAAACTGG - Intergenic
1107240469 13:38228129-38228151 AAGTCTGTTTTGTCAGAAACTGG + Intergenic
1109604566 13:64675722-64675744 ATTGCTGTGCTGTGAGTAACGGG + Intergenic
1111236478 13:85415789-85415811 AATTATGTGCTAAAAGAAAATGG + Intergenic
1111382711 13:87479463-87479485 GATTCTGAGCTGTGAGAAAAAGG + Intergenic
1111860509 13:93698964-93698986 AATTCTGTGCTTCAAGAACTAGG + Intronic
1113218114 13:108067309-108067331 AATTCAGTGTTGTAGTAAACGGG + Intergenic
1113276049 13:108731626-108731648 TATTCTGCACTGTGAGAAACAGG - Intronic
1113509136 13:110838057-110838079 AACTCTGTGCTCGCAGAAACAGG - Intergenic
1116982064 14:51182149-51182171 AATTCAGTGCTGTAGGAGAAAGG + Intergenic
1120790898 14:88580892-88580914 ACTTTTGTGCTGGAAGAAAATGG + Intronic
1121788378 14:96680103-96680125 AATGCAGTGCTGCCAGAAACTGG + Intergenic
1123136886 14:106036064-106036086 AATTATCTGTTGTAAGACACAGG + Intergenic
1124806934 15:32893638-32893660 AATTATGTGATTTATGAAACTGG - Intronic
1125017645 15:34952219-34952241 AATTCTTTGCTCTAAGTAATTGG - Intronic
1126337405 15:47602171-47602193 AATTCTATACAGTAACAAACAGG + Intronic
1127735296 15:61833882-61833904 ATTTCTTTGCTTTAAGAGACAGG + Intergenic
1127968411 15:63941093-63941115 CCTTCAGTGCTTTAAGAAACAGG - Intronic
1128173331 15:65531500-65531522 GATTCTGGGCTTTGAGAAACTGG + Intronic
1128729518 15:70011311-70011333 CAGTCTGTGCTGCAAGAAGCAGG + Intergenic
1130245766 15:82247073-82247095 AAATCTGGGCTGTATGAAGCAGG + Intronic
1131939533 15:97545748-97545770 CTTTCTGTGCTGTGAGAAAATGG - Intergenic
1135189003 16:20339156-20339178 ATTTCTTAGCTTTAAGAAACAGG - Intronic
1135236047 16:20757160-20757182 AATTCTGTGCAGAAAGTCACTGG + Intronic
1135574667 16:23576147-23576169 AAGTCTGTGCTCTTAGATACTGG + Intergenic
1135959092 16:26980892-26980914 AATTCTCCACTGTAAGAAAGGGG + Intergenic
1138703123 16:58886078-58886100 AGTCCAGTGCAGTAAGAAACTGG + Intergenic
1140221855 16:73049235-73049257 CTTTCTGTGCTGTGAGAATCGGG - Intronic
1140933330 16:79648234-79648256 AATTCTTTGCTGTAAGTGACAGG - Intergenic
1149236263 17:54594191-54594213 AAATCTGTTCTGTAAGGCACTGG + Intergenic
1149522383 17:57327433-57327455 AATTCTGGGCTGAAAGCCACAGG - Intronic
1150711706 17:67536021-67536043 AAGGATGTGCTGTAAGAAAGAGG + Intronic
1151886247 17:76924883-76924905 CATTCTGGGCTCTAAGGAACTGG + Intronic
1155542373 18:26881879-26881901 AATTCTCTGCTCTTAGAGACTGG + Intergenic
1155753516 18:29459705-29459727 AATCCTATCCTTTAAGAAACTGG - Intergenic
1156659468 18:39329743-39329765 AATTCTGTACTGTCAGCCACAGG + Intergenic
1158249573 18:55472151-55472173 CATTGTGTGCTGTCATAAACAGG + Intronic
1158509967 18:58081524-58081546 AATTCTCTGCTTTAAAAAATGGG - Intronic
1158881366 18:61782480-61782502 AGGTCTGTGTTTTAAGAAACAGG + Intergenic
1158986407 18:62822085-62822107 AATATTTTGCTTTAAGAAACAGG - Intronic
1159221124 18:65464347-65464369 TGTTCTGTGCTCTCAGAAACAGG - Intergenic
1159528282 18:69622467-69622489 AATTCTGTGAAATAAGCAACAGG + Intronic
1161729735 19:5952002-5952024 ATTTCTGTGCTTTAGGAAAGAGG + Intronic
1163051367 19:14686687-14686709 AATGCTGGGCTTTAAGAAGCTGG + Intronic
1164214631 19:23134269-23134291 AATTCTGTGCTTTCAGATCCCGG + Intronic
1164349483 19:27318488-27318510 AATTCTGTGATGTAAGTCATTGG + Intergenic
1166174499 19:41057191-41057213 AATTGAGTGCAGTAAGAGACTGG - Intergenic
1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG + Intronic
1167496306 19:49820838-49820860 AGTTCTGTGCTGGAAGAGCCAGG - Intronic
925921629 2:8642240-8642262 AATTTTGTGCTGTTAAAAATTGG - Intergenic
926440833 2:12886879-12886901 AATTCAGTGCTATCAGAAATAGG - Intergenic
926632905 2:15153601-15153623 AATTTTAAGCTGGAAGAAACTGG - Intergenic
926927947 2:18007162-18007184 AATTTTGTTGTGTAAGCAACAGG - Intronic
927185338 2:20478289-20478311 AATTGGCAGCTGTAAGAAACTGG - Intergenic
928900285 2:36310186-36310208 AAGTCTGTTTTGTCAGAAACTGG - Intergenic
929303164 2:40329304-40329326 CATTCAGTGCTGTAAAATACAGG - Intronic
929625324 2:43400866-43400888 AATTCTGTGCTGTTTTAAAAAGG + Intronic
931096928 2:58951187-58951209 AATTCTGTGATGGAAGAAGTTGG + Intergenic
933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG + Intergenic
935762326 2:106332828-106332850 CTTTCTGTGCCGTAAGCAACAGG + Intergenic
936846052 2:116834840-116834862 AATTGTGTTTTGTAAGTAACAGG - Intergenic
937855417 2:126669117-126669139 AATCCTGTGCTTGAAGAGACAGG + Intronic
938330966 2:130447810-130447832 TATTCTGCAATGTAAGAAACAGG - Intergenic
938358983 2:130673693-130673715 TATTCTGCAATGTAAGAAACAGG + Intergenic
939473723 2:142658543-142658565 AATTCTGTGCAGCATGATACTGG + Intergenic
940263133 2:151806038-151806060 AATTCTGTGCATTGAGAAAGTGG - Intronic
940416507 2:153428657-153428679 AATTGTTTCGTGTAAGAAACAGG + Intergenic
940724711 2:157323831-157323853 AATTGTGTTCTTTAAGAAAATGG - Intronic
941175616 2:162194488-162194510 AATTCTTTGCAGTGAGAACCTGG - Intronic
941191398 2:162387689-162387711 AATTGTGTTCTGTAAAAAAGCGG - Intronic
941850875 2:170178652-170178674 AATTCTGTGCAGAAATAAAGTGG - Intronic
942241476 2:173966190-173966212 AATTCTGTGTTTTAAAAAATCGG + Intergenic
942343469 2:174975756-174975778 AATTCTGTCATGTATGAACCTGG - Intronic
943943368 2:194027736-194027758 TATTATGTGCAGTAAAAAACTGG + Intergenic
945183202 2:207112812-207112834 AATTTTGTGATTTAAAAAACAGG - Intronic
945288684 2:208107302-208107324 AATTCTGTACTACAAGAAAGTGG + Intergenic
945506997 2:210653856-210653878 TAATCTGTGCTGTAAGAACAAGG - Intronic
945632439 2:212297448-212297470 AATTGTTAGCTTTAAGAAACAGG - Intronic
948074654 2:235156478-235156500 AATTCTGACCTTTAAGGAACAGG - Intergenic
948758798 2:240177477-240177499 TATTCTGAACTGTAAGAAAATGG - Intergenic
948767466 2:240230673-240230695 AATTCTGTGGAGTGAAAAACGGG + Intergenic
1169304575 20:4477372-4477394 TTTTCTGTGCTGTGAGAACCAGG - Intergenic
1170429844 20:16265871-16265893 CTTTCTGTGCAGTAAGCAACAGG - Intergenic
1170724782 20:18916720-18916742 AACTCAGTGCTATAAGAAAAGGG + Intergenic
1173828738 20:46064353-46064375 AAGTCTGTGCTGTAAGAGTGAGG + Intronic
1174126235 20:48309021-48309043 AATACTGAGCTGTCAGAACCTGG - Intergenic
1175155707 20:56969973-56969995 AAATCTGTGCTGTAAAGAAGAGG - Intergenic
1178131977 21:29583761-29583783 GATGCTGTGCTGTAAGACACTGG + Intronic
1180197600 21:46207021-46207043 AAGTCTGTGCTGCCAGAAAAGGG + Intronic
1181901878 22:26162872-26162894 AATTCTATGATGTCAGCAACTGG - Intergenic
1185207189 22:49546766-49546788 AACTCGGTACTCTAAGAAACAGG + Intronic
949980938 3:9501323-9501345 AAGTCTGTGCTGTACAAAACAGG + Exonic
950807720 3:15621568-15621590 AATTCTGTCTTTTAAGAAATTGG + Intronic
953312538 3:41893014-41893036 CTTTCTGTGCTGTGAGCAACAGG + Intronic
954598367 3:51847143-51847165 AATACTATGTTGTAAGATACTGG + Intergenic
954908813 3:54086193-54086215 ACTTCTAGGCTGTAAGGAACAGG - Intergenic
955069550 3:55560692-55560714 AATTCTGATATGTAAGAAAATGG + Intronic
957650492 3:82996549-82996571 AATTCTGTGCTGAAAGTCAATGG - Intergenic
958483893 3:94678712-94678734 AAGTCTGTTTTGTCAGAAACTGG - Intergenic
958717201 3:97799327-97799349 ATTTCTGGACTATAAGAAACTGG - Intronic
959491641 3:106996940-106996962 AATTCTGTGGAGTAAGGACCAGG - Intergenic
960554446 3:119011818-119011840 AATGCTGTGTTGTAAGATTCTGG - Intronic
963335165 3:143966793-143966815 TGTTCTGTGCTGAAACAAACTGG + Intergenic
963957456 3:151270492-151270514 AATTCTGTGCACTAATACACAGG - Intronic
965327693 3:167328190-167328212 AATTCTGTGTTTTAAAATACAGG + Intronic
969249701 4:5958935-5958957 AATTCTTTGCTGTAGGAGGCTGG + Exonic
969889400 4:10245746-10245768 ATTTCTGTGCTGCAAGCAGCAGG - Intergenic
971874559 4:32290248-32290270 CATTCTTTGCTGTGAGCAACAGG - Intergenic
972336555 4:38112016-38112038 AAATCTGTCCTGCATGAAACTGG - Intronic
973544883 4:51971521-51971543 AAGTCTGTTTTGTCAGAAACTGG + Intergenic
973995346 4:56453031-56453053 AAATCTCTGCTTTAGGAAACAGG + Intronic
974054544 4:56972296-56972318 ACAGCTGTGCTGTAGGAAACAGG - Intronic
974899499 4:67980137-67980159 AAGTCTGTTTTGTCAGAAACTGG + Intergenic
974920435 4:68232677-68232699 TATTCAGTGCTGTAAGAAGCTGG + Intronic
975490629 4:74984495-74984517 AATTCTGTGCCTTTGGAAACAGG - Intronic
976136388 4:81941580-81941602 AAAGCTGTGATGAAAGAAACTGG + Intronic
976603370 4:86959782-86959804 CATTCTGGGCTGAAAGAACCAGG + Intronic
978299974 4:107257130-107257152 AATGCTGTGCTATGAGAAAAAGG - Intronic
979617180 4:122756740-122756762 AATTCAAACCTGTAAGAAACTGG - Intergenic
979732592 4:124043411-124043433 AACTCTGTTTTGTCAGAAACTGG + Intergenic
980796405 4:137689713-137689735 AATTCTTTTCTGTAAGAAATTGG + Intergenic
982144801 4:152374499-152374521 ATTTTTGTGCTGTAAGAATGTGG - Intronic
982465911 4:155731885-155731907 AAGTCAGTCCTGTAAGATACGGG - Exonic
982817076 4:159899439-159899461 AATGCTGTGCTTTCAGAATCAGG - Intergenic
982822224 4:159955498-159955520 AATGCTGTGCTTTAAAAAAGTGG - Intergenic
984497201 4:180513743-180513765 TATTCTGTGCATTAAGACACAGG - Intergenic
985997960 5:3607389-3607411 AATTCTTAGGTGTAAGAAAGGGG - Intergenic
986600948 5:9472395-9472417 AATTCTGTGCTGTGAGAATAAGG + Intronic
986722482 5:10569662-10569684 AATTCTGAACTGTGAGAAAGCGG + Intronic
986764182 5:10908800-10908822 AATTCAGTGCTGATTGAAACAGG - Intergenic
987530821 5:19116836-19116858 AAATCTGTTTTGTCAGAAACTGG - Intergenic
988355530 5:30169116-30169138 AATTCTGAGCTTTAAGCAACAGG + Intergenic
990601956 5:57367797-57367819 AATTCTGATCAGTAAGAAATTGG - Intergenic
990994820 5:61721393-61721415 AATTTTATCCTGTAAGAAATGGG + Intronic
991342077 5:65622784-65622806 AATTCTGTGCTGTAAGAAACTGG + Intronic
991687962 5:69199048-69199070 ATTTCTGTGCAGCAAGCAACAGG - Intronic
991971046 5:72141952-72141974 AGTGCTGTGCTGGGAGAAACAGG - Intronic
995394101 5:111669327-111669349 ATTTCTATTCAGTAAGAAACAGG + Intronic
996605778 5:125319783-125319805 AAATCTGTGGTGTTAGAAATTGG - Intergenic
996721712 5:126637087-126637109 AATTATTTGCTGTAGGAAATTGG - Intergenic
996778389 5:127157893-127157915 AAGTCTGTTTTGTCAGAAACTGG + Intergenic
998920345 5:147061028-147061050 AATTCTGACCTGAAAGAAAGAGG + Intronic
999059444 5:148617787-148617809 AATTCATTACTGTAAGAACCAGG - Intronic
1004175128 6:13333291-13333313 GATTCTGTGATGCAAAAAACAGG + Intergenic
1007309602 6:40934939-40934961 CTTTCTGTGCCTTAAGAAACTGG + Intergenic
1007957011 6:45927295-45927317 AGGGCTGTGCTGTGAGAAACAGG - Intronic
1008375919 6:50791629-50791651 AATTCATTGCTGTCACAAACTGG - Intergenic
1008376050 6:50793527-50793549 AATTCATTGCTGTCAGAAATTGG - Intergenic
1008386795 6:50901141-50901163 GATTCTGGCCTGTAAGAAAGAGG - Intergenic
1008674298 6:53803097-53803119 TCTTCTGTACTGTAACAAACAGG + Intronic
1008922932 6:56861847-56861869 AATTCTGAGGTGGAAGAAATGGG + Intronic
1009195733 6:60682116-60682138 AAAGCTGTGTTGTAAGGAACTGG + Intergenic
1010242749 6:73631714-73631736 AATGCAGTGCTGTAAGGTACAGG - Intronic
1011002253 6:82604207-82604229 AGGCCTGTGCTTTAAGAAACTGG - Intergenic
1011007674 6:82665566-82665588 TATTCAGTGTTGTAAGAAACTGG - Intergenic
1012619428 6:101322603-101322625 AAGTCTGTTTTGTCAGAAACTGG + Intergenic
1012860225 6:104550822-104550844 ATTTCTATGCTGGAAGAAAGTGG - Intergenic
1014297882 6:119642660-119642682 ACTTGTGGGCTGTAAAAAACTGG + Intergenic
1014326785 6:120006885-120006907 AATTCTGTGATATAATAAAGTGG + Intergenic
1014422575 6:121263291-121263313 AAGTCTGTTTTGTCAGAAACTGG - Intronic
1014601411 6:123417783-123417805 AATACTGTGATATGAGAAACCGG - Intronic
1014874873 6:126645013-126645035 AATTCAATGATGGAAGAAACTGG - Intergenic
1014880573 6:126719104-126719126 ACATCTGTGCTGTGAGAAACAGG - Intergenic
1015213237 6:130721346-130721368 GATTCGGTGGTGAAAGAAACAGG - Intergenic
1015731804 6:136356538-136356560 AATTCTGTACTCCAAGAAAGTGG - Intronic
1016982940 6:149869549-149869571 CTTTCTGTGCTGCAAGCAACAGG - Intergenic
1017696912 6:157024880-157024902 ATTTCTGAGCTATAAGAAAAAGG + Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1020027625 7:4910444-4910466 AATTCAGTGGGGAAAGAAACAGG - Intronic
1020411736 7:7899879-7899901 AATACTGTCCTTTATGAAACTGG - Intronic
1020426825 7:8076496-8076518 TATTTTGTGCTGTTAGACACTGG - Intronic
1020439356 7:8201222-8201244 AATTTTGGGCTGTCAGAAGCTGG - Intronic
1020788130 7:12593957-12593979 AATTCTTTGATGTAAGTATCAGG + Intronic
1022219331 7:28297045-28297067 ATTGCTGTGCTGTAAGATAAGGG + Intergenic
1023074394 7:36468474-36468496 AATTCTGTGCTTAAGGAACCAGG - Intergenic
1026396004 7:69955091-69955113 AAAGCTGTGCTGTAGGAAGCTGG + Intronic
1027207879 7:76117457-76117479 AATTATGTGCTTTTAGTAACAGG - Intergenic
1028858101 7:95614885-95614907 AAGTCTGTTTTGTCAGAAACTGG - Intergenic
1030443407 7:109618348-109618370 CTTTCTGTGCTGCAAGCAACAGG - Intergenic
1032318840 7:130866508-130866530 AATTCTGTGCTATGAGACTCTGG + Intergenic
1032961661 7:137042342-137042364 AATTCTGAACTGTAAAATACAGG + Intergenic
1035652740 8:1281277-1281299 CATTGTGTTCTGTGAGAAACGGG + Intergenic
1036085643 8:5610251-5610273 ACTTCTGTGTTGAAAGAGACAGG - Intergenic
1039291618 8:36101365-36101387 GATTTAGTGCTGTTAGAAACTGG + Intergenic
1040740876 8:50573287-50573309 AATTCAGGGATTTAAGAAACAGG + Intronic
1041124612 8:54622374-54622396 GTTTCTGTGGTGGAAGAAACTGG - Intronic
1042339359 8:67662973-67662995 AAGTCTGTTCTCTAAGAAACAGG + Intronic
1042464494 8:69111811-69111833 AATTCTATGATGGAAGAAACAGG - Intergenic
1042838530 8:73100080-73100102 AATCCTGTGCTGCTAGAAAATGG + Intronic
1043432678 8:80210115-80210137 AATTTTGTGTTGAAAGAAAATGG + Intronic
1045003437 8:97897470-97897492 ACTGCTGTGCTGTAAGAGGCTGG - Intronic
1047670704 8:127143082-127143104 CATTCTGTGCTGTGAGCAGCAGG - Intergenic
1048693582 8:136996567-136996589 AATGTTGTGATGGAAGAAACTGG - Intergenic
1050128349 9:2383014-2383036 AATTCTGTCTTATAAGAAACTGG - Intergenic
1050401529 9:5261232-5261254 AAATCAATGCTTTAAGAAACTGG + Intergenic
1050504276 9:6331163-6331185 AATTCTATGCTTTCAGAACCTGG - Intronic
1051184186 9:14441554-14441576 AATTCTGGGCTATATGCAACTGG - Intergenic
1051200433 9:14614097-14614119 GATTCTCTGATGTCAGAAACTGG + Exonic
1051501794 9:17786135-17786157 AATTCTGTTCTGGATGAAGCAGG - Intronic
1052046296 9:23798078-23798100 AAATCTGTTCTGTAAGCAATAGG + Intronic
1053196529 9:36123671-36123693 AATTATATGTTGTAAGCAACAGG + Exonic
1056643754 9:88392405-88392427 AATTCTGTGCTGAAGGTATCTGG + Intronic
1057405950 9:94770992-94771014 AATACTGTGCAGGAAGAATCAGG - Intronic
1058460842 9:105181098-105181120 AAGTCTGTGCTGAAAGAATTGGG - Intergenic
1058563814 9:106259662-106259684 AATTCTTTTCTTTAAGAAATTGG + Intergenic
1059704388 9:116807022-116807044 AATTCAGTTCTGTTAGAAAAAGG + Intronic
1060319267 9:122540641-122540663 AATTCTGTGCAGAAAGTCACTGG + Intergenic
1060455945 9:123797159-123797181 AATTCTGCCCTTTAAGAAGCAGG + Intronic
1062090498 9:134675864-134675886 AAGTCTAGGCTTTAAGAAACTGG - Intronic
1186171889 X:6885544-6885566 GCTTCTGTGCTGTTATAAACAGG - Intergenic
1187259141 X:17669116-17669138 AATTCTGTGAAGTCAGAAAGTGG - Intronic
1188908803 X:35820648-35820670 CATTCTGTGCTGTGAGCAACAGG - Intergenic
1191768059 X:64722337-64722359 ACTTCTGTGATGCAAGAAGCGGG - Intergenic
1192026580 X:67458773-67458795 AAGTCTGTTTTGTCAGAAACTGG - Intergenic
1194790352 X:98140497-98140519 AATTATGTGGAGTAAGAAATGGG - Intergenic
1196420308 X:115514197-115514219 GATTCTTTGCTGTAAGATTCAGG + Intergenic
1197117501 X:122850766-122850788 AACTCTCTGCTATAAGAAGCAGG - Intergenic
1199462202 X:148097074-148097096 AATTGTATGCTGTAAACAACAGG + Intergenic
1202277575 Y:23140252-23140274 AATTATGTGCTCTAAGAATTGGG + Intronic
1202279543 Y:23166813-23166835 AATTCTGTGCTCTAAGAATTCGG + Intronic
1202280108 Y:23175195-23175217 AATTCTGTGCTCTAAAAAGTGGG + Intronic
1202280270 Y:23177647-23177669 AATTCTGCGCTCTAAGAATTGGG + Intronic
1202280837 Y:23186040-23186062 AATTCTGTGCTCTAAAAAGTGGG + Intronic
1202280999 Y:23188495-23188517 AATTCTGCGCTCTAAGAATTGGG + Intronic
1202284889 Y:23230019-23230041 AATTCTGTGCTCTAAGAATTCGG - Intronic
1202288453 Y:23280436-23280458 AATTATGTGCTCTAAGAATTGGG - Intronic
1202430567 Y:24773976-24773998 AATTATGTGCTCTAAGAATTGGG + Intronic
1202432675 Y:24802884-24802906 AATTCTGTGCTCTAAGAATTCGG + Intronic
1202436565 Y:24844412-24844434 AATTCTGCGCTCTAAGAATTGGG - Intronic
1202436727 Y:24846867-24846889 AATTCTGTGCTCTAAAAAGTGGG - Intronic
1202437292 Y:24855254-24855276 AATTCTGTGCTCTAAGAATTCGG - Intronic
1202440225 Y:24896111-24896133 AATTATGTGCTCTAAGAATTGGG - Intronic