ID: 991344717

View in Genome Browser
Species Human (GRCh38)
Location 5:65651604-65651626
Sequence TGTTTTGAAACTATTTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 940
Summary {0: 1, 1: 0, 2: 10, 3: 88, 4: 841}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991344717_991344719 -1 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344719 5:65651626-65651648 ACTGGTTTAGCACATTTATGTGG No data
991344717_991344721 1 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344721 5:65651628-65651650 TGGTTTAGCACATTTATGTGGGG No data
991344717_991344723 3 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344723 5:65651630-65651652 GTTTAGCACATTTATGTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 127
991344717_991344726 8 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344726 5:65651635-65651657 GCACATTTATGTGGGGGGGGTGG 0: 1
1: 1
2: 3
3: 35
4: 313
991344717_991344724 4 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344724 5:65651631-65651653 TTTAGCACATTTATGTGGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 157
991344717_991344720 0 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344720 5:65651627-65651649 CTGGTTTAGCACATTTATGTGGG No data
991344717_991344727 13 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344727 5:65651640-65651662 TTTATGTGGGGGGGGTGGTGAGG No data
991344717_991344722 2 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344722 5:65651629-65651651 GGTTTAGCACATTTATGTGGGGG No data
991344717_991344725 5 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344725 5:65651632-65651654 TTAGCACATTTATGTGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991344717 Original CRISPR TGTTTTGAAACTATTTTTGA TGG (reversed) Intronic
900909623 1:5585826-5585848 TATTTAGAAAATAATTTTGAGGG + Intergenic
901957897 1:12800097-12800119 TGTTTTGCAACTATTGTAAAGGG - Intergenic
901965897 1:12865844-12865866 TGTTTTGCAACTATTGTGAAGGG - Intronic
901981293 1:13036224-13036246 TGTTTTGCAACTATTGTGAAGGG - Intronic
902000792 1:13192705-13192727 TGTTTTGCAACTATTGTGAAGGG + Intergenic
902020023 1:13338409-13338431 TGTTTTGCAACTATTGTGAAGGG + Intergenic
902029920 1:13414765-13414787 TGTTTTAAAACTTTTATTAAAGG - Intronic
903252783 1:22068263-22068285 TGTTTTGTAACTAGTTCTGATGG - Intronic
903514149 1:23898975-23898997 TGTTTTCATTCTATTTTTGATGG + Intronic
904776380 1:32910200-32910222 TGACTTGCAAATATTTTTGATGG - Intergenic
905124180 1:35705793-35705815 TCTTTTGAAACTAATTTTGATGG - Intergenic
906091513 1:43183538-43183560 ATTTATGAAACTATTCTTGATGG - Intronic
906121413 1:43394575-43394597 TGTTTTGAAAATATAGTTGTTGG + Intronic
906583925 1:46959099-46959121 TATTTTGTAACTATTTTAAACGG - Intergenic
906887232 1:49662374-49662396 GTCTTTTAAACTATTTTTGAGGG - Intronic
906923112 1:50085916-50085938 AGTTTTAAAACTAGTTGTGAGGG + Intronic
907001748 1:50866581-50866603 TGTTTTGCAGCTATTTTAAAGGG - Intronic
908238052 1:62166395-62166417 TGTGTTAAGACTATTTTTAAGGG + Intergenic
908648643 1:66307805-66307827 TGTTTTTAAATTACTGTTGATGG + Intronic
908655010 1:66379411-66379433 CTTTTTGAAACTGTATTTGATGG - Intergenic
908849976 1:68366074-68366096 AGTTTAGAAGCTATTTTTGCTGG + Intergenic
909511883 1:76462492-76462514 GGTCTTGAAATTAATTTTGAGGG + Intronic
909679937 1:78280396-78280418 TGTTTAGTAAATATGTTTGATGG - Intergenic
909763025 1:79317157-79317179 TATTTTGAACCTATTTTTTAAGG - Intergenic
909780038 1:79532878-79532900 TGTTCACAAACTATTTCTGAGGG + Intergenic
909861813 1:80615789-80615811 AGTTTGGAAAATATATTTGAGGG - Intergenic
910148190 1:84107546-84107568 TAGTTTGAAAATATTTTTGTAGG - Intronic
910589751 1:88918167-88918189 TTTTTTGAAATTATTTTTGCAGG + Intergenic
911077358 1:93890208-93890230 TGGTTTGAAAATATTTTTCGAGG - Intronic
911313134 1:96321857-96321879 CGTTTTGAAACTGTTTTTGCTGG - Intergenic
911478685 1:98408201-98408223 TTTTTTAAATCTATTCTTGATGG + Intergenic
911520140 1:98919745-98919767 TGTTTTGAAAATGTATTTGCAGG - Intronic
911656992 1:100455167-100455189 TGTTTAGAAACTTTTATTTACGG - Intronic
911922951 1:103790476-103790498 AGTTTGGAAACCATGTTTGAAGG - Intergenic
912224925 1:107722514-107722536 TGTCTTGAAAATATTTTTTGAGG - Intronic
913427009 1:118743969-118743991 TTTTTTGTAAATATTTTTAATGG - Intergenic
914692760 1:150046009-150046031 TGTTTTGAAATTATTTTTAATGG - Intergenic
915221829 1:154380708-154380730 TGTTTTGAATCAATTTTTCTTGG - Intergenic
915709544 1:157882379-157882401 TCTTTTGCAACCATCTTTGATGG + Intronic
916049389 1:161024726-161024748 TGTTTTGAAAATATTAATAATGG + Intronic
916102359 1:161403411-161403433 AGTTTTGAAACTAGTTTTTATGG + Intergenic
916189544 1:162165809-162165831 TTTTATGAAACTCTTTTTGGAGG + Intronic
916640439 1:166722786-166722808 TTTTTAAAAATTATTTTTGATGG - Intergenic
916706009 1:167351050-167351072 TGTTTTGAAACTATTAATGTTGG + Intronic
916875644 1:168965469-168965491 TATTTTGATAATATTGTTGACGG - Intergenic
916892720 1:169128378-169128400 TCTTTTGAAAATATTATTCATGG - Intronic
917451929 1:175154407-175154429 TGTTTTGATAGTATTTCTCAAGG + Intergenic
917551491 1:176035591-176035613 TATTTTGAAACTATTGTTAAGGG - Intronic
918986574 1:191636092-191636114 GTTTTTGATACTATTTTAGATGG - Intergenic
919106538 1:193159115-193159137 TTTTTTCCAACTTTTTTTGACGG + Intronic
919278461 1:195452110-195452132 GGTTTTGCCACTATTTTCGATGG + Intergenic
919450086 1:197761291-197761313 TATTTAGAAAATATTTTTGAAGG - Intronic
919596660 1:199572350-199572372 GTTTTTGAAAGTATTTTTTAAGG + Intergenic
919702952 1:200650143-200650165 TCCTTTGAAAATATTTTAGAAGG - Intronic
920800080 1:209178163-209178185 AGTTTGGAAAATATATTTGAGGG + Intergenic
921527526 1:216236141-216236163 TTTTTTAAAACAATTTTTAAGGG + Intronic
921738518 1:218656377-218656399 TGTCTTGTAAATATTTTTAAAGG - Intergenic
922215728 1:223518415-223518437 TGTTTTCAAACTATCTTATAAGG + Intergenic
922992005 1:229922053-229922075 TTTTTTGAAGTTATTTTTGAAGG + Intergenic
923327054 1:232889475-232889497 TGATTAGAAACTATTTCTGAAGG - Intergenic
923423531 1:233844772-233844794 TGATCTGAATCTATTTTTAAGGG - Intergenic
923583078 1:235237171-235237193 TCTTTTGAAAGTATGTTTTAAGG - Intronic
924671364 1:246129485-246129507 TTTGGTGAAACTATCTTTGAGGG + Intronic
1063073586 10:2691559-2691581 TGAATTAAAACTATGTTTGAAGG + Intergenic
1063183111 10:3624147-3624169 TGTTTTCAAAGTATTCTTTATGG - Intergenic
1063229588 10:4051477-4051499 TGTTTTGGAAATATTAGTGAAGG - Intergenic
1063798809 10:9546483-9546505 TGTTTTGAAACAATTATTCTTGG + Intergenic
1063805904 10:9640233-9640255 TTGGGTGAAACTATTTTTGAGGG - Intergenic
1064559479 10:16582129-16582151 TATTTTAAAAATATTTTAGAGGG + Intergenic
1065033175 10:21609256-21609278 TGTTTAGACACTATTTTCCAAGG + Intronic
1065079603 10:22114798-22114820 TGATTTCAAACTATGCTTGAAGG - Intergenic
1065223490 10:23519770-23519792 TGTGTTGCAATTGTTTTTGAGGG + Intergenic
1065372325 10:25000480-25000502 TATTTTGAAACTCTGTTTGTAGG + Intronic
1065476046 10:26139219-26139241 TATTTTTAATCTATTTTTGATGG - Intronic
1065842991 10:29720373-29720395 TTTTTGGAAGCTATTTTTGCTGG - Intronic
1066822757 10:39515094-39515116 AGTTTTGAAACTCTTTTTGTAGG + Intergenic
1066823644 10:39531690-39531712 ACTTTTGAAACTCTTTTTGCAGG + Intergenic
1067156628 10:43786678-43786700 GGTTTTGTAAGTTTTTTTGAAGG - Intergenic
1067482750 10:46614871-46614893 TTATTTGAAAATCTTTTTGAAGG - Intergenic
1067487515 10:46664962-46664984 TATTTTGCCATTATTTTTGAAGG + Intergenic
1067607290 10:47677047-47677069 TATTTTGCCATTATTTTTGAAGG - Intergenic
1067612004 10:47726793-47726815 TTATTTGAAAATCTTTTTGAAGG + Intergenic
1067856164 10:49795444-49795466 GCTTTTGAAACTAATTTTGTTGG + Intergenic
1068294667 10:55054411-55054433 TTTTTTGAATCTACTGTTGATGG + Intronic
1068479500 10:57572084-57572106 TCTTATGAAACTAATTTTGTAGG - Intergenic
1068602126 10:58967341-58967363 TGTTTTGAAACCATAAATGAAGG - Intergenic
1068607068 10:59017362-59017384 TGTTTTTAAATTATTTTTGTGGG + Intergenic
1069147336 10:64910654-64910676 TTTTTTCAATTTATTTTTGATGG + Intergenic
1069149836 10:64946272-64946294 TGTTTTTCAATTAATTTTGATGG - Intergenic
1069322814 10:67194072-67194094 TTTTTTAAAACTATGTTTGTTGG + Intronic
1069380286 10:67836512-67836534 TATTATCAAACAATTTTTGAAGG - Intronic
1069471420 10:68694005-68694027 TCTTTTAAAAATATTTCTGAGGG - Exonic
1069731843 10:70621914-70621936 TGATTTGGAACTTATTTTGAAGG - Intergenic
1070123521 10:73601203-73601225 TGTTTTGGAGCTTTTATTGATGG - Intronic
1070985166 10:80682947-80682969 TATTTTGAAATTATATTGGAAGG + Intergenic
1071033922 10:81219220-81219242 TTTTTGCAAACTATTTTTTATGG - Intergenic
1071166052 10:82808170-82808192 TGTGTAGAAATTATGTTTGAGGG - Intronic
1071233963 10:83622623-83622645 TGTTTTGAAGCATTTCTTGAAGG - Intergenic
1071622847 10:87138426-87138448 TATTTTGCCATTATTTTTGAAGG - Intronic
1071819834 10:89268630-89268652 TTTTTTGAAATCATTTTTAATGG + Intronic
1072274289 10:93807414-93807436 TATTTTAAAACAATATTTGATGG - Intergenic
1072599104 10:96907264-96907286 GGGTTTGAAAGTATTCTTGAAGG + Exonic
1073567743 10:104549751-104549773 TGTTATGAATCTATTTTGAAAGG + Intergenic
1073707775 10:106005363-106005385 TGTTTTTTACCTTTTTTTGATGG - Intergenic
1073820378 10:107255830-107255852 AGTTTGGAAAGTATATTTGAGGG + Intergenic
1073848047 10:107582020-107582042 TGTTTTTAAAATCTATTTGAAGG - Intergenic
1073879636 10:107965874-107965896 GGTTTTAAAACTACTTATGATGG + Intergenic
1074292666 10:112151434-112151456 TGCTTTGAAAATCTTTTTTAAGG - Exonic
1074486811 10:113892300-113892322 GGTTCTGAAAATATTTTTAAAGG - Intronic
1074896489 10:117781800-117781822 TATTTTAAATTTATTTTTGAAGG + Intergenic
1075047482 10:119157780-119157802 TGTTTTTAAATTATCTTTGCTGG - Intronic
1075901443 10:126045756-126045778 TATTTTGAAACTCTTCATGAAGG + Intronic
1076598571 10:131641843-131641865 TTTGTTTATACTATTTTTGAGGG - Intergenic
1076977785 11:188433-188455 TATTTTAAAAATATTGTTGATGG + Intronic
1077854552 11:6109833-6109855 TTATTTGAAACTATTTTTATAGG - Intergenic
1077924277 11:6664853-6664875 TGGATTGAAAATATTTTGGAAGG - Intergenic
1078238412 11:9507434-9507456 GATTCTGAAACTATTTTAGATGG - Intronic
1078493647 11:11794147-11794169 TTTTTTCAAACTTTTTTTAATGG + Intergenic
1078676119 11:13416039-13416061 TGTTTTAAAACTTTTTTTTGAGG - Intronic
1078768173 11:14319730-14319752 TATTTTGAAAATATTTTACAGGG - Intronic
1079471821 11:20785848-20785870 TGTTTTGAAACTGTATTTGCAGG + Intronic
1079477000 11:20841619-20841641 TAGTTTAAAACTATTTTTGGAGG + Intronic
1079878131 11:25886916-25886938 TATTATAAAACTATTTTTGTTGG - Intergenic
1080169213 11:29278885-29278907 TATTTTAAAAATATTTTTCAAGG + Intergenic
1080223315 11:29932468-29932490 GGTTTTGAAACTATTTAAAATGG + Intergenic
1080439183 11:32274943-32274965 TGTTTTGACAATATTTTTAAAGG - Intergenic
1080777662 11:35401336-35401358 TATGTTGAAAATATATTTGAGGG + Intronic
1081091817 11:38879402-38879424 TGTTTTGAAAATGTGTTAGATGG + Intergenic
1081251447 11:40839849-40839871 TGGATTGAAATTATTTTTTATGG - Intronic
1081294053 11:41363616-41363638 TGAGTTGAAAATGTTTTTGAAGG - Intronic
1081321569 11:41698006-41698028 TATTTTGAAATTATATTTCAAGG + Intergenic
1082571468 11:54745413-54745435 AGGTTGGAAACTATTTTTGTAGG - Intergenic
1082580534 11:54861783-54861805 AGTTTGGAAACTGTTTTTGTAGG + Intergenic
1082588854 11:54979768-54979790 TGTTTTGAAAGAATTCATGAAGG + Intergenic
1082846892 11:57733735-57733757 TGTTTTAAAACTTTTTATTATGG - Intronic
1082932846 11:58626836-58626858 TTTTTTAAAAACATTTTTGATGG - Intergenic
1083535147 11:63460300-63460322 TGTTTTAAAAATATTCTTGTTGG - Intergenic
1084583955 11:70044082-70044104 GGTTTTTAAACTATATGTGAAGG + Intergenic
1084708174 11:70828112-70828134 TGTTTTTAAATTATTTTTCATGG - Intronic
1086039108 11:82453359-82453381 TGTTTTGAAACAATTATTCTTGG - Intergenic
1086156262 11:83669643-83669665 TGTTTTGACTCTATTTTGAAGGG + Intronic
1086224363 11:84489840-84489862 TGTCTTGGAATTATTTTTGCCGG + Intronic
1086524107 11:87704302-87704324 TCTTTTTAAAATATTTTTTATGG + Intergenic
1086997760 11:93378187-93378209 TGTTTGGAAAACATATTTGAGGG - Intronic
1087305219 11:96481593-96481615 TGTTTTGAAATTACATTTAAAGG - Intronic
1087749604 11:101992808-101992830 TATTTGTAAAGTATTTTTGATGG - Exonic
1087920523 11:103861665-103861687 TGTCTTAAAACTATTGTTGGGGG + Intergenic
1087982293 11:104630621-104630643 TGTTTTGCAACTATTTTAAATGG + Intergenic
1088372317 11:109105446-109105468 AGTTTGGAAAATATATTTGAGGG - Intergenic
1088677327 11:112206934-112206956 TGTTTTGAAATTATTGTAAATGG + Intronic
1090819552 11:130329031-130329053 TGTTTTGAAAGAATTATTGTTGG + Intergenic
1090931946 11:131305589-131305611 TGGTTTGAAAAAATATTTGATGG + Intergenic
1090969883 11:131632032-131632054 TATTCTGAAACAATTTTTCAAGG + Intronic
1091974897 12:4816654-4816676 TTTTTTGAAATTTTTTTTGTGGG + Intronic
1092893145 12:12988196-12988218 TCTTTTGAATGTATTTTTTAGGG - Intronic
1093239225 12:16648832-16648854 TGTTTTAAAAATATTTTTAGTGG - Intergenic
1094133851 12:27103064-27103086 TGTATTTAAACTATTTTTTGTGG + Intergenic
1094388383 12:29920486-29920508 GGTTATGAACCTATTTTTAATGG - Intergenic
1094584596 12:31766152-31766174 TGTTTTGAAACTAGTGGTGATGG + Intergenic
1094722437 12:33077916-33077938 TGTATTGAAATGATTTTTGGGGG + Intergenic
1094794922 12:33960494-33960516 TGTTTTGCAGCTATTATTGTTGG - Intergenic
1094808454 12:34113272-34113294 TGTTTTGCAAGTGTTTGTGAAGG + Intergenic
1094866257 12:34534630-34534652 TGTTTTTGAAGAATTTTTGAAGG - Intergenic
1094868080 12:34563341-34563363 TGTTTTTTAAGAATTTTTGAAGG - Intergenic
1095106724 12:38242777-38242799 TGTTTTGCAACTATTATTGTTGG - Intergenic
1095410188 12:41912922-41912944 TGTTTGGATGCTGTTTTTGAAGG - Intergenic
1095539481 12:43292026-43292048 TGTTTTGCCATTATTTTTAATGG - Intergenic
1095634107 12:44411221-44411243 TTTTTTGAAAATAATTTTGTTGG - Intergenic
1096922805 12:55107026-55107048 TCCTTTGAAACTTCTTTTGAAGG - Intergenic
1097415141 12:59305878-59305900 TTTTATGAAACTATTTTAAAAGG + Intergenic
1097527179 12:60751519-60751541 GGGTTTTAAACTTTTTTTGATGG + Intergenic
1097706516 12:62874413-62874435 TGTTTTTAAATTTTCTTTGAGGG - Intronic
1098374005 12:69792821-69792843 TGTTTTTAAAATATGTTTGAAGG - Intronic
1098414863 12:70221476-70221498 TGGTTTCAAAATATTTTTCAAGG + Intergenic
1098536657 12:71600863-71600885 GGTTTGGAAACTAGTATTGATGG - Intergenic
1098553815 12:71795247-71795269 TGCTTTGACAATATTTTTAAGGG - Exonic
1098610326 12:72449479-72449501 TGTTTTAAAAAGCTTTTTGAAGG - Intronic
1099086223 12:78249211-78249233 TGTTTTTAAATCATTTGTGAAGG + Intergenic
1099187537 12:79532424-79532446 TGTATTGAGAATATTATTGATGG + Intergenic
1099221149 12:79916294-79916316 TTTTGTGAAAATATTTTTGAAGG - Intronic
1099331025 12:81287571-81287593 TGTGTAGAAACTATTTCTGTCGG - Intronic
1099455087 12:82853455-82853477 TGTGTTGAAACCCTTTTTGGTGG + Intronic
1099550322 12:84035502-84035524 TGTTTTAAAAATGTTTTTTAGGG + Intergenic
1101460500 12:104886779-104886801 TGTTTTCATACTTTATTTGAGGG - Intronic
1101522165 12:105494101-105494123 TGTTTTAAAACTATTTAAGAAGG + Intergenic
1102149816 12:110681064-110681086 TGTTTTTAAACCATTTTGGATGG + Intronic
1102245063 12:111350642-111350664 TTTTTTAAAACTAGTTTTTAAGG + Intergenic
1102821885 12:115915555-115915577 TGTATTAATATTATTTTTGATGG - Intergenic
1103089803 12:118089808-118089830 GGTTTGGAAAATATTTTGGAAGG - Intronic
1103876222 12:124129445-124129467 TGTTTTAAAATTTTTTTTGTAGG + Intronic
1105616135 13:22014503-22014525 TGTTTTAAAACTATTTCAAAAGG + Intergenic
1105624077 13:22096413-22096435 TGGTGTGAAACTATTTATGAAGG + Intergenic
1105644383 13:22301946-22301968 GGTTTTGAAAATATTTTTACTGG + Intergenic
1105670844 13:22613549-22613571 TTTTTTGATACTATTTTAAATGG + Intergenic
1105868261 13:24480525-24480547 TGTAAAGAAACAATTTTTGAAGG + Intronic
1106113363 13:26796327-26796349 TGTTTAGAAACTATTCTAAATGG + Intergenic
1107222166 13:37996099-37996121 TGTTTTAAAATTATTTTTGAAGG + Intergenic
1107945535 13:45414802-45414824 TGTTTTGGAGCTCTTTCTGAAGG + Intronic
1108859397 13:54835874-54835896 TGTATTGAAACTCTGTTTTAAGG + Intergenic
1108873130 13:55011615-55011637 TTCTTTGAAACTATTTTTGATGG + Intergenic
1109057289 13:57567081-57567103 TATTTTGAAACTAATTGTCACGG + Intergenic
1109066929 13:57707453-57707475 TGTTTTGAATATACTATTGAAGG - Intronic
1109140550 13:58709841-58709863 TTTTTTGAAACTTTTTTGAAAGG - Intergenic
1109484705 13:63003114-63003136 AGTTTGGAAAATATATTTGAGGG + Intergenic
1109493955 13:63143723-63143745 TGTTTTGAAAGATTTTGTGAAGG - Intergenic
1109567544 13:64137005-64137027 TGTCTTTAACCCATTTTTGATGG - Intergenic
1109596952 13:64569126-64569148 TGTTTGGAAAACATATTTGAGGG - Intergenic
1110736072 13:78938322-78938344 ACATTTGAAACTCTTTTTGATGG - Intergenic
1111052446 13:82902806-82902828 TTTTTTTAAACTAGTTTTCAAGG + Intergenic
1111140547 13:84112752-84112774 CATTTTGAAACTATTTTTAGGGG + Intergenic
1111148619 13:84217969-84217991 AGTTTGGAAAATATGTTTGAGGG + Intergenic
1111419021 13:87985352-87985374 AGATTTGAAATTATTTTTTAGGG + Intergenic
1111557933 13:89905863-89905885 TGATTTTAAAATTTTTTTGATGG - Intergenic
1111579380 13:90203127-90203149 TGTTTTTAAATTAATTTAGAGGG - Intergenic
1111580416 13:90215272-90215294 TGTTCAGAAAATATTTGTGAAGG - Intergenic
1112136810 13:96588000-96588022 TGTTTTGATGCTATTTTGAATGG + Intronic
1112417579 13:99216710-99216732 TATTTTGAAACAACTTTGGAAGG + Intronic
1112634998 13:101207355-101207377 TGTTTAGAAAATATTTTTGGTGG + Intronic
1112716929 13:102197789-102197811 TGATCTAAAACTATTTTGGATGG - Intronic
1112862937 13:103856973-103856995 TGTTTTGAAATTATTTAAGTAGG + Intergenic
1113183808 13:107662616-107662638 TGTTTTCAAGTTATTTTTAATGG - Intronic
1113210974 13:107980546-107980568 TGTTTTGATACTATTATGAATGG + Intergenic
1113538598 13:111088137-111088159 TGTTTTGAGACTATTGTTCTTGG - Intergenic
1113604093 13:111592603-111592625 TCTTTTGAATCTATTTTAGATGG + Intronic
1114005548 14:18309273-18309295 TCTTTTTAAATTATTTTTAAAGG + Intergenic
1114023884 14:18506641-18506663 TGTTTAGGAATCATTTTTGAGGG - Intergenic
1114081782 14:19207236-19207258 TGTTCTTAAACTAATTTTGTGGG - Intergenic
1114139056 14:19890606-19890628 TGTTTTTAAACTTTTTTTTTTGG + Intergenic
1114543443 14:23481027-23481049 TGTTTTCAAACTATATTCTAAGG - Intronic
1114762808 14:25335466-25335488 TGATTTGAAAATATGTTTCAAGG + Intergenic
1115204203 14:30884465-30884487 GGTTTTAAAACTGTTTTTTAAGG + Intronic
1115229192 14:31140301-31140323 AGTTTTGAAAAAATATTTGATGG + Intronic
1115260403 14:31446809-31446831 TGTTTTCAAACTATTCTTATGGG + Exonic
1115392878 14:32873359-32873381 TTTTTTGCAACTATTTTGAAAGG + Intergenic
1115684656 14:35783371-35783393 TGTGTTGAAAAGACTTTTGAAGG - Intronic
1116184473 14:41579598-41579620 TATTTTAAAAATATTGTTGATGG + Intergenic
1116586671 14:46714538-46714560 GGTTTTGAAGCTAGTTTTGGAGG + Intergenic
1116657462 14:47671019-47671041 TTATTTGAAAATATTTCTGAAGG - Intronic
1116662112 14:47723675-47723697 TGTTTTGGGATCATTTTTGATGG + Intergenic
1116721169 14:48497615-48497637 TATTTGTAAACTACTTTTGAAGG + Intergenic
1116770487 14:49121774-49121796 TGTAATGAAACTATTGTTAATGG - Intergenic
1116789154 14:49321085-49321107 AGTTCTGAAACTTTTTTTGGTGG + Intergenic
1116931567 14:50695936-50695958 TTTTTTGAATTTATTTTTGTAGG + Intergenic
1117003819 14:51398015-51398037 TGTTTCTAAACTTTTTTTCAAGG - Intergenic
1117103655 14:52377229-52377251 AGTTTGGAAAACATTTTTGAGGG - Intergenic
1117223197 14:53627971-53627993 TGTTTTTAACCTCTTTTTAATGG - Intergenic
1117266702 14:54096175-54096197 TTTTTTGAAATAGTTTTTGAAGG - Intergenic
1117601739 14:57382948-57382970 TGTATTGTAATTATTTCTGAGGG + Intergenic
1117855123 14:60023031-60023053 TTTTTAGAAACCATTTTTAAAGG + Intronic
1118140058 14:63071199-63071221 AGTTTGGAAAATATATTTGAGGG - Intronic
1118178361 14:63465264-63465286 TTGTTTAAAACTAATTTTGAAGG - Intronic
1118360973 14:65056133-65056155 TGTTTTCAAACTTTTTGTAATGG + Intronic
1118520043 14:66573088-66573110 TGTATTGAAACTTATTTTGTGGG + Intronic
1119013825 14:71027760-71027782 TGTTTTGAAAATTTTTTGAAGGG + Intronic
1119131396 14:72176187-72176209 TGCTTTGAAGCAGTTTTTGAGGG + Intronic
1119340418 14:73872400-73872422 TATTATAAAACTATTTTTTATGG - Intronic
1119565759 14:75627877-75627899 AGATTTGAAAAAATTTTTGACGG + Intronic
1120285484 14:82495297-82495319 TGGTTTTAAAATATTTTAGATGG + Intergenic
1120412873 14:84179257-84179279 TGTTCTGAAAATATAATTGACGG + Intergenic
1120775409 14:88430552-88430574 TATTATGAAAATATTTTTAAAGG - Intronic
1121810906 14:96889092-96889114 TTCTTTGAAACTTTTTTGGAAGG + Intronic
1123227341 15:17054074-17054096 AGTTTGGAAACTGTTTTTGTAGG + Intergenic
1123386340 15:19810946-19810968 AGTTTGGAAACTCTTTTTGTAGG - Intergenic
1123387614 15:19831364-19831386 AGTTTGGAAAATCTTTTTGAAGG - Intergenic
1123792440 15:23735550-23735572 TTTTTTGAAAATATGTTTTATGG + Intergenic
1123893095 15:24801275-24801297 TTTTTTGTCACTTTTTTTGATGG + Intergenic
1124081183 15:26499553-26499575 TGTTTGAAAACTATTTTTGCTGG + Intergenic
1124210452 15:27759416-27759438 AGTTTTTAAATTATGTTTGATGG + Intronic
1124559708 15:30760345-30760367 TGTTTTAAAACTTTTTATTATGG - Intronic
1124671542 15:31645376-31645398 TGTTTTAAAACTTTTTATTATGG + Intronic
1125044788 15:35232850-35232872 TCTCTTGCAACTATTTTTGTAGG - Intronic
1125740550 15:41960446-41960468 TGTTTTCAAAGAATTTTTAATGG - Intronic
1125854160 15:42933117-42933139 TGTTTTGAAACTCAGTTTTATGG - Intergenic
1125896388 15:43306273-43306295 TGTTTAGAACCTCTATTTGAAGG + Intergenic
1125988799 15:44084409-44084431 TGTTTGGATACTATTATTGTTGG + Intronic
1126107512 15:45156326-45156348 TGTTCTGATCCTATTTTTGGGGG + Intronic
1126186797 15:45838629-45838651 TGTTTTAAAAATATATTTCATGG + Intergenic
1126282412 15:46970153-46970175 TTTTTTGAAATAATTTTAGAAGG - Intergenic
1126880542 15:53090953-53090975 TGTTTTAAGACTACTTTTTATGG + Intergenic
1126977438 15:54199252-54199274 AGTTTGGAAAACATTTTTGAGGG + Intronic
1126980132 15:54232211-54232233 TGTTTTGAGGCTATCTGTGAAGG + Intronic
1127133889 15:55898518-55898540 TGTTTTGAAATTATTAAAGAAGG - Intronic
1127594020 15:60459874-60459896 TTTTTTTAAACTCCTTTTGAGGG - Intronic
1128015741 15:64344160-64344182 TGTTTTGAAACAGTCTTTAATGG - Intronic
1128099986 15:64990529-64990551 TGTTTTGAATTTTTTTTTTAGGG + Intergenic
1128488026 15:68116146-68116168 TGTTTTGAAAACATTTATGTAGG + Intronic
1128826089 15:70718775-70718797 TATTTTAAAATTATTTTTGGTGG - Intronic
1129010720 15:72414219-72414241 TTATTTTAAACTATTTTTGTTGG - Intergenic
1129171886 15:73812933-73812955 TTTTTTTAAACTATTTTTAAGGG - Intergenic
1130338899 15:82982261-82982283 TTTATTGAAACCATTTTTGATGG - Intronic
1130393907 15:83485236-83485258 TGTTTGGATACTATTTGTGTGGG + Intronic
1130779913 15:87025371-87025393 TGTTTTGCAGCTATTTTAAAAGG - Intronic
1130981609 15:88815614-88815636 TGTCTTGAAATTGTTCTTGATGG - Intronic
1131309478 15:91276021-91276043 AATTTTGAAAATATTTTTGCTGG + Intronic
1131627072 15:94132786-94132808 AGTTTGGAAAATATATTTGAGGG - Intergenic
1132210144 15:100015948-100015970 AGTTTGGAAAATATATTTGAGGG - Intronic
1133151033 16:3830573-3830595 TGTTTTGAAACTGTTTTATTAGG - Intronic
1134251359 16:12576389-12576411 CGTTTTAAAAATATTTTTAATGG - Intergenic
1136697363 16:32096499-32096521 TGATTTGTTACTATTTTTTAAGG + Intergenic
1137908013 16:52345314-52345336 TATTTTGAAACTATTTTAAATGG - Intergenic
1138038789 16:53638278-53638300 TGTGTTAAAATTATTTTGGAAGG - Intronic
1138775020 16:59710751-59710773 TTTTGTCAAACTATTTTTTAAGG - Intronic
1138883220 16:61042202-61042224 TGTTTTAAAATGTTTTTTGAAGG - Intergenic
1138899838 16:61255559-61255581 AATTTTTAAACTATTTTAGAAGG - Intergenic
1139017560 16:62708531-62708553 GGTTTCTAAAATATTTTTGAGGG - Intergenic
1139197348 16:64935021-64935043 TATTTTGAAACTCTTTTATAAGG - Intergenic
1139200206 16:64967780-64967802 TGTTTTAATACCATTTTTGTTGG + Intronic
1139332441 16:66203862-66203884 TCTGTGGGAACTATTTTTGAGGG - Intergenic
1140395921 16:74626672-74626694 TGTTTTGTAACTGTTCTTGATGG - Intronic
1140574005 16:76141973-76141995 TGTTTTGTAATTATTTTTCAGGG - Intergenic
1141737716 16:85865423-85865445 TGTTTTGCAAATATTTTTTGTGG + Intergenic
1142465206 17:132898-132920 TATTTTAAAAATATTGTTGATGG + Intergenic
1142910652 17:3088087-3088109 AGTTTTGAAAACATATTTGAGGG - Intergenic
1142911396 17:3096075-3096097 TTTTTTCACTCTATTTTTGAAGG - Intergenic
1143413987 17:6732288-6732310 TGTTTTAAAGCTTTTTTTGTAGG - Intergenic
1144349491 17:14381197-14381219 TTTTTTGAAAATATTTTTGGGGG + Intergenic
1146753484 17:35404288-35404310 TGTTTTTAAAAGATTTTGGAAGG - Intergenic
1147061381 17:37881728-37881750 AGTTTTGCAATTAATTTTGATGG - Intergenic
1147389072 17:40098426-40098448 TGTTGTGCAACTATTTTCCAAGG - Intronic
1149130802 17:53299229-53299251 TTTTTTAAAACTTTTTTTGTTGG - Intergenic
1151029287 17:70717336-70717358 TTTTCTGAATCTATTTTTGAAGG + Intergenic
1152913179 17:83017044-83017066 TGTCTTACAAATATTTTTGAGGG - Intronic
1152959386 18:69766-69788 TATTTTTAAAATATTATTGATGG + Intronic
1152973958 18:195298-195320 TGTTTAAAAAATATTTTTGGAGG - Intronic
1153082418 18:1243251-1243273 TGTTTTGCAACTGTCTTTGAAGG + Intergenic
1153592175 18:6685115-6685137 TCTTTTGATAATATTTTTGTAGG + Intergenic
1153756456 18:8288394-8288416 TGTTATTAAACTGTTTTTTAGGG + Intronic
1153853399 18:9119169-9119191 TGTTTAGACATTCTTTTTGATGG + Intronic
1154531884 18:15354601-15354623 TCTTTTTAAATTATTTTTAAAGG - Intergenic
1154534637 18:15389116-15389138 AGTTTGGAAAATCTTTTTGAAGG + Intergenic
1155229759 18:23761176-23761198 TGCTTTGACATCATTTTTGATGG + Intronic
1155481223 18:26289979-26290001 AGTCTTCATACTATTTTTGATGG - Intronic
1155577724 18:27266133-27266155 TGTTTGGAAGCTACTGTTGATGG - Intergenic
1155879612 18:31128325-31128347 TATTTTGAAAATATTTTAAATGG + Intergenic
1156288192 18:35720913-35720935 TATTTTGACACTATTTTAAATGG - Intergenic
1156589184 18:38466840-38466862 TCTTTTGATGCTAATTTTGAAGG - Intergenic
1156737613 18:40279842-40279864 TGTTTAATAACTACTTTTGAAGG - Intergenic
1156749039 18:40428044-40428066 TGTGTTGAAATTATTTTTTAAGG + Intergenic
1158200100 18:54930550-54930572 TGTGTTCAAATTATTTCTGAAGG + Intronic
1158574126 18:58621924-58621946 TGTTTTGAATTTATTTTAGGTGG + Intronic
1158610579 18:58936299-58936321 CGTTTTGAAACTATTATTAATGG + Intronic
1158646591 18:59254093-59254115 TGTTTTGATCCTAATTTTTAGGG - Intergenic
1159094607 18:63888090-63888112 TGTTTTGACACTAAATTTGATGG + Intronic
1159411033 18:68074416-68074438 TTTTTTGAAAGTATTATTGGGGG + Intergenic
1160061920 18:75537228-75537250 TATTTTGATACTATTTTAAATGG + Intergenic
1160206021 18:76832968-76832990 TTTCCTGAAACTATTGTTGATGG + Intronic
1160218280 18:76953326-76953348 TCTTTTGAAACTGGTTTTGCAGG + Intronic
1161609002 19:5230624-5230646 TGTTTTAAAAATGTTTTTGGAGG + Intronic
1163208401 19:15821401-15821423 TGTCTTGAAGCTCTTTTTGATGG - Intergenic
1163936725 19:20452614-20452636 TAATTTGAAACTATATTTCAAGG - Intergenic
1164038411 19:21473531-21473553 TCTTTAAAAAATATTTTTGAGGG - Intronic
1164337257 19:24339323-24339345 TGTTTTGGAAGTATCTGTGAAGG + Intergenic
1164337899 19:24349895-24349917 TGTTTTGGAAGTATCTGTGAAGG + Intergenic
1164360072 19:27496822-27496844 TGTTTTGGAAGTATCTGTGAAGG + Intergenic
1166573209 19:43812559-43812581 TCTTTTCAGACTATTTTTAAAGG + Intronic
1166899774 19:46050729-46050751 AGTTTTGAAAACATATTTGAGGG + Intronic
1167217780 19:48176259-48176281 TTTTTTTAAACTTTTTTTCAAGG - Intronic
1167662396 19:50803540-50803562 TGTTTTGAAAGTAAGTTTCATGG - Exonic
924973492 2:152911-152933 TGTTTTGAAATTGTTTTAAATGG + Intergenic
924992710 2:327623-327645 TGTTTGGAAAACATATTTGAGGG - Intergenic
925037047 2:695858-695880 AGTTTTGAAAATATTTATTAAGG - Intergenic
925484639 2:4314597-4314619 TGTTTGAAAGCTATTTTTGCTGG + Intergenic
925637760 2:5958342-5958364 AGTTTGGAAAATATATTTGAGGG - Intergenic
926459822 2:13115100-13115122 TCCTTTGAACCTATTTTTAAGGG - Intergenic
926813152 2:16774341-16774363 TGTTTTCAAACTATTTTTAAAGG + Intergenic
927506401 2:23617796-23617818 TGTTTTGAATCTATTTTTTTAGG + Intronic
928044453 2:27914656-27914678 TGTTATGAAATCATTTTAGAGGG + Intronic
929035459 2:37687349-37687371 TGTTATGAAACTTTCTTTAAAGG + Intronic
929474694 2:42234316-42234338 TGCTTTGAAACTATCTGGGAAGG + Intronic
930182652 2:48379434-48379456 TTTTTTAAAAGTATTTTTTATGG + Intergenic
930213281 2:48665962-48665984 AGTTTTGAAGCTATGTTTGTAGG + Intronic
930314262 2:49778643-49778665 TCTTTTGAAAGTAGTTTTGCTGG - Intergenic
930423092 2:51178058-51178080 AGTTTGGAAAATATATTTGAGGG + Intergenic
930639294 2:53838950-53838972 TCTGTTTAAATTATTTTTGAAGG + Intergenic
930704629 2:54492245-54492267 TGTTTTGAAAACACTTTTTATGG + Intronic
930997893 2:57743937-57743959 TGATTTGTAACTTTCTTTGAGGG + Intergenic
931195359 2:60047619-60047641 TGTTTTCAACCTTTTTATGAGGG - Intergenic
931274266 2:60730464-60730486 TGTTTTAAATTTATTTTTTATGG - Intergenic
931465297 2:62481194-62481216 TGTTTTGTAACTATTGTAAATGG + Intergenic
931521464 2:63101942-63101964 TTTTTTGTAACTATTTTAAATGG + Intergenic
931768898 2:65480642-65480664 TGCTTTGAGACTACTTGTGAAGG - Intergenic
931834779 2:66086846-66086868 AGTTTGGAAAATATATTTGAGGG + Intergenic
931866448 2:66417378-66417400 TGTTTTGATATTTGTTTTGAAGG + Intergenic
931956536 2:67432462-67432484 TGTTTTAAAAAAATTTTTTAGGG + Intergenic
932471208 2:71960456-71960478 TTTTTTAAAACTATTTTTAGTGG + Intergenic
933221043 2:79688860-79688882 TGTTCTGAAACTATTTTCTATGG + Intronic
933434226 2:82225255-82225277 AGTTTTCATAATATTTTTGAAGG - Intergenic
934890476 2:98064089-98064111 TGTTTTGGAAGAATTTTTGAAGG + Intergenic
934934728 2:98456771-98456793 TGTTTTGTGACTATTATTGTAGG + Intronic
937101890 2:119277869-119277891 ATTTTTGAAACTATATTTTAAGG + Intergenic
937421768 2:121762782-121762804 GTTTTTGATAGTATTTTTGAGGG + Intronic
937572595 2:123382086-123382108 AGTTTGGAAAATATATTTGAGGG + Intergenic
937663159 2:124453442-124453464 TGTTTGGAAAATATATTTGGGGG + Intronic
937686254 2:124700873-124700895 TTTTTTGCCACTATTTTTAATGG + Intronic
937828818 2:126398280-126398302 AGTTTGGAAAATATATTTGAGGG - Intergenic
938494802 2:131789358-131789380 TGTTTTTAAACTAATTTTGTGGG + Intergenic
938881157 2:135590834-135590856 TGTTTTTAAGCTATTTTTACTGG + Intronic
939071896 2:137554246-137554268 TGAATTGAAACAATTATTGAAGG - Intronic
939166404 2:138645677-138645699 GATTTGGAAAATATTTTTGAGGG + Intergenic
939437173 2:142192941-142192963 TCTTTTTAAAATATTTTTAATGG + Intergenic
939476079 2:142687962-142687984 TTTTTGGATACAATTTTTGATGG - Intergenic
939828258 2:147041726-147041748 TTTTTTGAGACTATTTTACATGG + Intergenic
939851143 2:147306586-147306608 TGCTTAAAAATTATTTTTGATGG - Intergenic
939919952 2:148098005-148098027 TGTTTAGAAATTAATTCTGATGG + Intronic
940538285 2:154975415-154975437 TGTTTTAAAAATATGTTTAAGGG + Intergenic
940568380 2:155398544-155398566 TGTTTTGAACATATATTTAAAGG + Intergenic
940866849 2:158825920-158825942 TATTTTTAAACTAGTTTTGGGGG + Intronic
941307295 2:163886069-163886091 TATTTGGAAAATATATTTGAAGG + Intergenic
941461338 2:165775462-165775484 TCTTTTCAGACTATTTCTGAAGG + Intronic
942745152 2:179223449-179223471 ATTTTTTAAATTATTTTTGATGG - Intronic
943199172 2:184796931-184796953 GGTTTTGAATATTTTTTTGAGGG + Intronic
943229920 2:185236072-185236094 CACTTTGAAACTAATTTTGAAGG + Intergenic
943600589 2:189915957-189915979 TGTTGGGTAACTAGTTTTGATGG - Intronic
943993781 2:194733282-194733304 CATTTAGAAAATATTTTTGATGG - Intergenic
944397313 2:199283028-199283050 TGCTATGAAAATAGTTTTGATGG - Intronic
945018884 2:205551263-205551285 TGTTTTTAAACTATTTCTTATGG - Intronic
945074652 2:206025895-206025917 TGTTTTGAAATTTTTTTTTTTGG + Intronic
945421617 2:209644439-209644461 AGTTTTGAATCTAATTTTCAGGG - Intronic
945462496 2:210126085-210126107 TAATTTGAACATATTTTTGAAGG - Intronic
945628414 2:212239461-212239483 TATTTTGATAATATTTTGGATGG - Intronic
945834607 2:214823698-214823720 TGTTTTCCAACTATTTTTAATGG + Intergenic
946796325 2:223357832-223357854 TTATTTGAAAATTTTTTTGAAGG + Intergenic
946799777 2:223401663-223401685 TTTTTTCAAACTTTTTGTGAGGG + Intergenic
946941326 2:224772792-224772814 TGTTTCAAAACAATTTTTTAAGG + Intronic
947175001 2:227357130-227357152 TGTTGAGACAGTATTTTTGAGGG - Exonic
947175174 2:227358984-227359006 TGTCTTGATATTATTTTAGAGGG - Intergenic
947843193 2:233222350-233222372 TGTTATGAAACAATTTTGAATGG - Intronic
948171029 2:235903027-235903049 TGTGTTGAAATTTGTTTTGATGG - Intronic
948273691 2:236692520-236692542 TTTTTTTAAACTAATATTGATGG + Intergenic
948624167 2:239257954-239257976 TACTTTGAAACTATTGTTTATGG - Intronic
1169158603 20:3356365-3356387 AGCTCTGAAACTATATTTGAAGG + Intronic
1169485711 20:6030017-6030039 TTGTTTGAAAGTATTTTGGAAGG + Intronic
1170136438 20:13079499-13079521 TATTTTGAAAGTGTTTTTGGTGG - Intronic
1170145670 20:13171361-13171383 TTTGTTGAAAATATTTTAGAGGG - Intergenic
1170322451 20:15115232-15115254 TCTTTTTAAACTTCTTTTGACGG + Intronic
1171038798 20:21740584-21740606 TATTTTAAAAGTATTTTTGTTGG + Intergenic
1171073008 20:22093467-22093489 TGTTTAGAAGCTATTTTTAGAGG - Intergenic
1171491552 20:25522585-25522607 TATTTGACAACTATTTTTGAGGG - Intronic
1172334416 20:34102125-34102147 TGCTTGAATACTATTTTTGAAGG - Intronic
1173110775 20:40187246-40187268 TGTTTTGAAGCTATGTTTAAGGG + Intergenic
1173253453 20:41376472-41376494 TGTTGTAAAACTTTTTTTGGGGG - Intergenic
1173379234 20:42523486-42523508 TGTTTTGTAAATATTGTTCATGG + Intronic
1173395640 20:42677229-42677251 GGTTTTGAAAATTTTCTTGATGG - Intronic
1173568501 20:44059426-44059448 AGTTTGGAAAATATATTTGAGGG + Intronic
1173788098 20:45809714-45809736 TGTTCAAAAACTATTGTTGAGGG + Intronic
1176613141 21:9004922-9004944 TGTTTTTAAACTAATTTTATAGG - Intergenic
1176712040 21:10158890-10158912 TGTTTTTAAACTAATTTTATAGG + Intergenic
1176765479 21:13013572-13013594 TCTTTTTAAATTATTTTTAAAGG + Intergenic
1177229489 21:18301091-18301113 AATTTTGTAACTATTTTTGAAGG - Intronic
1177711508 21:24781574-24781596 GGTTTTGAAATTATCTTTTAAGG - Intergenic
1177730268 21:25020423-25020445 TTTTTTAAGGCTATTTTTGATGG - Intergenic
1177866831 21:26522373-26522395 TTTTTTTAAAAAATTTTTGAGGG - Intronic
1178101415 21:29272517-29272539 TATTTTCAAACTATTTTGAAAGG - Intronic
1179768472 21:43594143-43594165 TTTGTTGAAAATATTTTTGCTGG - Intronic
1179795425 21:43779888-43779910 TGTTTTCAAACCATCTTGGAGGG + Intergenic
1179938112 21:44617958-44617980 AGTTTGGACACTCTTTTTGAGGG - Intronic
1180325050 22:11363921-11363943 AGTTTTGAAACTCTTTTTGTAGG + Intergenic
1180329212 22:11461320-11461342 TGTTCTGAAATCATTTGTGAAGG + Intergenic
1180430057 22:15240059-15240081 TCTTTTTAAATTATTTTTAAAGG + Intergenic
1180448054 22:15434172-15434194 TGTTTAGGAATCATTTTTGAGGG - Intergenic
1180454986 22:15506792-15506814 TGTTTTGCAAGTGTTTGTGAAGG - Intergenic
1180498993 22:15915434-15915456 TGTTCTTAAACTAATTTTGTGGG + Intergenic
1180568044 22:16691925-16691947 TGTTTTGGAACTTTTTTTGAGGG + Intergenic
1180862398 22:19092698-19092720 TTTTTTGATACTATTGTTAATGG - Intronic
1181182970 22:21080106-21080128 TCTTTTAAAAATATTTTTGGGGG + Intergenic
1181306910 22:21922239-21922261 TTTTTTAAAGCTATTTTTCAAGG - Exonic
1183609220 22:38886394-38886416 TCATTTCAAACCATTTTTGAGGG + Intergenic
1183810778 22:40255374-40255396 TGTTTTGAGCCTATTTCAGAAGG + Intronic
949113643 3:293498-293520 TTTTTTAAAATTTTTTTTGATGG - Intronic
949461371 3:4298513-4298535 TATTTGGAAAATTTTTTTGAAGG - Intronic
949601206 3:5599868-5599890 TTTTTTAAATTTATTTTTGAGGG - Intergenic
949625990 3:5867325-5867347 TGTTTCGAAATTATTTCTCAGGG + Intergenic
950177485 3:10885487-10885509 TGTCTAGAAACATTTTTTGATGG + Intronic
950266937 3:11580920-11580942 TGACTTGAAACAATTTTTAAAGG - Intronic
950564327 3:13757712-13757734 TGTTTTGAAATGTTTTTTGTTGG + Intergenic
950743839 3:15071127-15071149 TTTTTAAAAACTATTTTTAAAGG - Exonic
950791064 3:15472717-15472739 TGTTTTGAAACTTTTACCGAGGG - Intronic
950841973 3:15976536-15976558 TGTTTTGTCATTATCTTTGAGGG + Intergenic
951074825 3:18377324-18377346 TGTTATGAAATTCTTTTTCAAGG + Intronic
951450743 3:22835426-22835448 TATTTTAAAACTAGTTTTCATGG + Intergenic
951714482 3:25625100-25625122 TGTTTGGAAACTACTGTTAAAGG - Intronic
951987491 3:28636841-28636863 TATTTTGAAAGTATTTTTAAGGG - Intergenic
952021678 3:29030155-29030177 TGTTATTAAACTGGTTTTGAGGG + Intergenic
952129280 3:30341354-30341376 TTTTCAAAAACTATTTTTGATGG - Intergenic
953012867 3:39044420-39044442 TGTGTTGAGACTTGTTTTGAGGG - Intergenic
953469020 3:43151068-43151090 TTTTTTGAAATTATTTGGGAAGG - Intergenic
953787908 3:45924398-45924420 TTTTTTCAGACGATTTTTGAAGG + Intronic
955316638 3:57944572-57944594 TTTTTTGAAACTTTTTTTTTTGG + Intergenic
955546802 3:60040084-60040106 TTTTTTGACACTATCTTTGTTGG - Intronic
956684447 3:71811578-71811600 AGTTTTTACACTAATTTTGAAGG + Intergenic
956963803 3:74434865-74434887 TGTTTTGAATCAAAATTTGATGG - Intronic
957224232 3:77422739-77422761 TGATTTGCACCTATTTTTTATGG + Intronic
957409041 3:79813581-79813603 TTTTTTGAAACTATGTTCGTTGG - Intergenic
957517384 3:81273474-81273496 TGTTTTGGAATTATCTCTGAAGG + Intergenic
957833883 3:85560325-85560347 TGTGTTAAAACCATTATTGATGG + Intronic
958453711 3:94304667-94304689 AATTTTGAAAATATTTTTGCTGG - Intergenic
958833432 3:99116404-99116426 GGATTTGAACCTATTCTTGAAGG - Intergenic
958919501 3:100088141-100088163 TTTTTTTAAACTACTTTTGTAGG + Intronic
958982116 3:100733949-100733971 TGTTTTGAAATAATTATTGTTGG + Intronic
959203168 3:103273798-103273820 AATTTTGAAATTGTTTTTGAAGG - Intergenic
959369144 3:105501529-105501551 TATTTTTAAATTATTTTAGATGG - Intronic
959632729 3:108526868-108526890 TGTTTTTCAATTCTTTTTGATGG - Intronic
959678040 3:109059176-109059198 CTTTGTGAAACTATTTTTAAGGG - Intronic
959720661 3:109483989-109484011 TATTTTAAAAATATTTTTGAAGG + Intergenic
960066433 3:113378580-113378602 TTTTATGAAATTATTTTTGGTGG + Intronic
960086006 3:113592269-113592291 GGTTTTGCCATTATTTTTGAAGG + Intronic
960112594 3:113859838-113859860 TTTTTTGAAAGAGTTTTTGAAGG - Intronic
960376007 3:116902241-116902263 TGTTTTCAAATTATTTTACAAGG + Intronic
960399717 3:117181337-117181359 TGTTATGAAACTAGTATTTATGG + Intergenic
960420485 3:117439363-117439385 TGTTTTAAAACTCTGTGTGAGGG + Intergenic
960441684 3:117696641-117696663 TGTTTTGAAACTAAGATTGAAGG - Intergenic
960848062 3:122022531-122022553 TGTTTTGCAAGTATTTATAAGGG - Intergenic
961088166 3:124087996-124088018 TATTTTTAAAATTTTTTTGAAGG - Intronic
961199288 3:125031294-125031316 GGTTTTGGTACTATTTTTTAGGG - Intronic
961227455 3:125264609-125264631 GGCTTTTAAACTTTTTTTGATGG - Intronic
962436205 3:135369181-135369203 AATTTTGAAACTATTGTTGGAGG + Intergenic
962539730 3:136367804-136367826 TGTTTTGAAAGTATTTGATAGGG - Intronic
962673599 3:137734996-137735018 CGTTTGGAAAATATCTTTGATGG - Intergenic
962762768 3:138531438-138531460 GGTTTTGTAACTATTTTTATTGG + Intronic
962763050 3:138534820-138534842 AGTTTTTAAACTACATTTGAAGG - Intronic
963108958 3:141669712-141669734 TTTTTGAAAACTATTTTTGTTGG - Intergenic
963373743 3:144436978-144437000 AGTTTGGAAAATATATTTGAGGG - Intergenic
963382462 3:144548994-144549016 TGTTTTAAAATTATTACTGAGGG + Intergenic
963628002 3:147697369-147697391 TTATTAGAAATTATTTTTGATGG + Intergenic
964211562 3:154234118-154234140 TGTTTTAAAACTCTGTTTTATGG - Intronic
964302665 3:155306354-155306376 TCTTTTAAAATTATTTTTGGTGG + Intergenic
964468166 3:157021524-157021546 TTTTTGAAAACTTTTTTTGAAGG + Intronic
964827561 3:160846514-160846536 TTTTTTGAAACAATCTTTCAAGG - Intronic
964934476 3:162064956-162064978 TCTTTTGGGACTATTTTTGTAGG + Intergenic
965110655 3:164417015-164417037 TGTTTTGTAACTCTTTTTAAAGG + Intergenic
965313891 3:167166492-167166514 GGTTGTGAAAAGATTTTTGAAGG + Intergenic
965318724 3:167224948-167224970 TTTGTTGAAGCTATTTTTGTGGG - Intergenic
965327018 3:167319144-167319166 TGTTATGAAAATATTTTTAAAGG + Intronic
965579026 3:170247377-170247399 TGTTTTAAAATTGTTTTAGAGGG + Intronic
965675850 3:171195380-171195402 TTTGTTGAAGATATTTTTGAAGG - Intronic
965773635 3:172207009-172207031 TATTTTGAACCTGTTTTGGAGGG + Intronic
965942584 3:174202473-174202495 AGTTTCAAAACTATTTTTCAGGG - Intronic
965968486 3:174525508-174525530 TGGTGTGAAACCATTTATGAGGG + Intronic
966024760 3:175263379-175263401 TGTTTTTAAAGTATTTTCCATGG + Intronic
966031488 3:175353741-175353763 TATTTGGAAACTAGGTTTGAGGG - Intronic
967193796 3:187009244-187009266 AGTTTTTAAATTATTTTTAATGG + Intronic
967314511 3:188138651-188138673 TGTTTGGAAACAATGGTTGAGGG - Intergenic
967430451 3:189378735-189378757 TGATTTGCTAATATTTTTGAGGG + Intergenic
967525304 3:190486138-190486160 TGTTTTGAATGTATTTGTTATGG - Intergenic
967796427 3:193603521-193603543 TGTTTGGAGTCCATTTTTGATGG + Intronic
967805146 3:193709246-193709268 GGTTTGGAAACAATTATTGATGG - Intergenic
968033337 3:195522956-195522978 TTATTTGCAACTATTTTTAAAGG - Intronic
968042258 3:195598642-195598664 GATTTTGAAGCTATTTTTGTGGG + Intergenic
968412144 4:399581-399603 TTTCTATAAACTATTTTTGACGG + Intergenic
968807327 4:2783552-2783574 AGTTTTGAAAACATATTTGAGGG - Intergenic
968865954 4:3211782-3211804 TTTCTTAAAAATATTTTTGATGG + Intronic
969471803 4:7393431-7393453 TTCTTTGAAACTACTTTTAATGG + Intronic
969685336 4:8670325-8670347 TGTTTTGAATCTGATTTTAAAGG - Intergenic
969933887 4:10661988-10662010 TGTTTTGGAAAGAGTTTTGATGG - Intronic
970052699 4:11933211-11933233 TTTTTTGAAAATAATTTTTAGGG - Intergenic
970183493 4:13424018-13424040 TGTTTTTAGCCTATTTTTAACGG - Intronic
970440794 4:16079716-16079738 TGTTCTCAAACTTTGTTTGAAGG - Intronic
970632926 4:17972864-17972886 GGTTTTGAGAGTATTTTAGAAGG - Exonic
970735471 4:19161879-19161901 TGTTTTGACCATACTTTTGAGGG - Intergenic
970749717 4:19343249-19343271 TGTTTTAAAAATGTTTTTAAAGG + Intergenic
971080114 4:23200127-23200149 TGAATTGAAACTATTTTCTAAGG - Intergenic
971576584 4:28282010-28282032 AGTTTTGAAAACATATTTGAAGG + Intergenic
971585533 4:28401356-28401378 TTGTTTGAGGCTATTTTTGATGG + Intronic
971753754 4:30682326-30682348 TGATTTGATAATATTTCTGATGG - Intergenic
972054898 4:34789163-34789185 TTTTTTGACACGAATTTTGAGGG - Intergenic
972100562 4:35409327-35409349 TGTTTTGATACGAAATTTGATGG + Intergenic
972161999 4:36238318-36238340 TGTTTGCAAACCATTTTTGTAGG + Intronic
972239272 4:37172479-37172501 TGTCTTGAAATTATTATTGTTGG - Intergenic
972685003 4:41343771-41343793 TGTTTAGAAACTATTGTTTAAGG - Intergenic
972952524 4:44345373-44345395 ACTTTTGAAACCATTTTTGGGGG - Intronic
974136977 4:57830827-57830849 TCTTATGGAAGTATTTTTGATGG + Intergenic
974630886 4:64486722-64486744 TGCTTTAAAATTATTTGTGAAGG - Intergenic
974870919 4:67640473-67640495 TTTTTTAAAACTTTTTTTTAGGG + Intronic
974947899 4:68550579-68550601 TGTTAAGAGACTAATTTTGAAGG - Intronic
975190535 4:71455669-71455691 AATTTTTAAACTTTTTTTGATGG + Intronic
975217510 4:71772684-71772706 GGTTTTGAAACTATTTTTGCTGG + Intronic
975674971 4:76818144-76818166 TGTTTTAAAACTTGTTTTGTGGG + Intergenic
976009142 4:80466437-80466459 TGTTTTAAAAAAAGTTTTGAGGG - Intronic
976013744 4:80524492-80524514 TGTTTTCAAATGATTCTTGAGGG + Intronic
976091463 4:81462178-81462200 AGTTTTGTTACTATTTTGGAAGG - Intronic
976123868 4:81812366-81812388 TGTTTTCAATCTACTGTTGATGG - Intronic
976137595 4:81955549-81955571 TGTATAGATAGTATTTTTGAAGG - Intronic
976472356 4:85444580-85444602 TTTTTTAAAAATATTTTTTAGGG - Intergenic
976908768 4:90273492-90273514 TTTTTTAAAATTATTTTTGTGGG - Intronic
977027474 4:91837458-91837480 CATTTTGAAATTATTTTTAAAGG - Intergenic
977127341 4:93186767-93186789 TGTGTTAAAACTATATTAGAAGG - Intronic
977196963 4:94075297-94075319 TATGTTAAAACTAGTTTTGATGG + Intergenic
977233858 4:94483190-94483212 TATTTTGAAACTAATTTTGAGGG - Intronic
977504977 4:97889935-97889957 TGTCTTCCAACTCTTTTTGAGGG - Intronic
977590135 4:98817145-98817167 TGTTTTTAAATTGTCTTTGATGG - Intergenic
977593186 4:98849394-98849416 TGTTTTGAAATTATTTTATTTGG + Intergenic
978160069 4:105535759-105535781 TATTTTGTAACTATTTTTAATGG - Intergenic
978825136 4:113013747-113013769 TGTTTTGAGTGTATGTTTGAGGG - Intronic
979011306 4:115373346-115373368 TGTATAGACATTATTTTTGATGG - Intergenic
979030033 4:115632379-115632401 AGTTTGGAAAATATATTTGAGGG - Intergenic
979326588 4:119387044-119387066 TGTTTTTAAACTATATTTCTGGG + Intergenic
980223484 4:129949695-129949717 TGTTTTGTCATTATTTTTAATGG - Intergenic
980675362 4:136071802-136071824 TGTTTTGACAGAAGTTTTGAAGG + Intergenic
980727285 4:136779778-136779800 TTTATTGAGACTATTTTTTATGG + Intergenic
982362713 4:154538414-154538436 TGTTATGCAACTCTTTTGGAGGG + Intronic
982635646 4:157893502-157893524 TTTTTAGAAACTTCTTTTGAAGG + Intergenic
982913065 4:161170059-161170081 ATTTTTAAAACTATTTTTTATGG + Intergenic
983321008 4:166196728-166196750 TTTTTTGAGACTATTTTAAATGG + Intergenic
983697553 4:170550711-170550733 TGTTTTGATATCATTTTTAAGGG + Intergenic
983754802 4:171321333-171321355 AGTTTGGAAAATATTTTTGAGGG + Intergenic
983804534 4:171977899-171977921 TGTTTTGAATATATTATTTAGGG + Intronic
983807689 4:172016144-172016166 TGTTTGGAAAACATATTTGAGGG - Intronic
984206736 4:176794124-176794146 TATTTTGAAAATATTTATCATGG + Intergenic
984357193 4:178677025-178677047 TTTTATGAAACTGTTTTTCAAGG - Intergenic
984469477 4:180148613-180148635 TATTTTAATACTATTTTTGTTGG + Intergenic
984681432 4:182614736-182614758 TGTTTTAAAATTATTTCTAAAGG + Intronic
985883110 5:2655789-2655811 TGTTTTTAAACTTTGTTTAAAGG - Intergenic
986060990 5:4189679-4189701 TATTTTAATACTATTTTTAATGG - Intergenic
986273679 5:6255584-6255606 TTTTTTCAAACTATTTTGGAGGG - Intergenic
987140408 5:14940040-14940062 TATTTTGAAAATACTTTTCATGG + Intergenic
987236376 5:15945838-15945860 TCTTTTAAAACTTTTTTTAAAGG + Intergenic
987832674 5:23116862-23116884 TGTTATAAATCTATTTTTTATGG + Intergenic
988002344 5:25364301-25364323 TGTTTGGAAAACATATTTGAGGG + Intergenic
988008195 5:25447686-25447708 TTTTGTGAAACTTTTTTTTAAGG + Intergenic
988234726 5:28527525-28527547 TGATTTGAATGTGTTTTTGATGG - Intergenic
988243368 5:28643687-28643709 TGTTTTAAAACTTTGTTTAAAGG + Intergenic
989018797 5:36974302-36974324 TGTTTTCTAACTAGTTTTGAAGG + Intronic
989776720 5:45217669-45217691 TGTCTAAAAAATATTTTTGAGGG - Intergenic
989805665 5:45600844-45600866 TGTTTAAATACTATTTTTGCAGG - Intronic
989897171 5:47104965-47104987 AGTTTTGAAACATTTTTTGTGGG - Intergenic
990455788 5:55986268-55986290 TGTTTTGAAACTATGTTATTTGG + Intronic
990588193 5:57233197-57233219 TGATTTGGAAGTATTTTGGATGG + Intronic
990863369 5:60353087-60353109 TGCTTGGGAACTATTTCTGAAGG - Intronic
991344717 5:65651604-65651626 TGTTTTGAAACTATTTTTGATGG - Intronic
991920515 5:71652068-71652090 TGAGTTGAAAGTATTTTTCAGGG + Intronic
992273575 5:75091180-75091202 TGTGATGAAAGTATTTTTTAAGG - Intronic
992666670 5:79016477-79016499 TGTTTTGATACTGTTGTAGATGG - Intronic
992952833 5:81877545-81877567 TGCTTTGATACTATTTTGAATGG - Intergenic
993002692 5:82397677-82397699 TGTCTTGATACTTTTATTGAGGG + Intergenic
993134513 5:83941339-83941361 TGTTTTAAAAATATTTTCCAAGG - Exonic
993263147 5:85687450-85687472 TTTTTTGAAACAATTTGTGAAGG + Intergenic
993334369 5:86639200-86639222 TATTTTAAAACTGTTTCTGATGG + Intergenic
993426085 5:87765795-87765817 TGTTTTGGAACTAGTTTAGAAGG + Intergenic
993851674 5:93017907-93017929 TCTTTTAAAATTATTTTTAAAGG - Intergenic
994347358 5:98702071-98702093 AGTTTGGAAAATATATTTGAGGG + Intergenic
994477181 5:100286279-100286301 TGTTTGAAGAATATTTTTGATGG + Intergenic
994568927 5:101488117-101488139 TGTTTAAAAGGTATTTTTGACGG + Intergenic
994711858 5:103275499-103275521 TCTTATGAAACTATGTATGATGG + Intronic
994827806 5:104738117-104738139 GATTTTGATGCTATTTTTGAGGG + Intergenic
995648640 5:114342648-114342670 TTTTTTAAAAATAATTTTGAAGG + Intergenic
995935282 5:117503671-117503693 AGTGTTTAAATTATTTTTGAAGG + Intergenic
996263472 5:121503910-121503932 TCTTTTCAAACTATTTTTCTAGG + Intergenic
996266319 5:121544780-121544802 ATTTTTGAAACTACATTTGAAGG - Intergenic
996560635 5:124825250-124825272 GATTTTGAAACTAATTTTTAAGG + Intergenic
996863010 5:128085496-128085518 ATTTTTGTAACTATTTTTTATGG + Intronic
996927368 5:128843828-128843850 TGTTATAAAGGTATTTTTGAGGG - Intronic
997020059 5:129989484-129989506 TGTTTTTAATCCATTCTTGAGGG + Intronic
998366216 5:141633940-141633962 TGTTTTTAAACTTTTTATTAGGG - Intronic
998418344 5:141961544-141961566 AGTTTTGAAAATAGGTTTGAAGG + Intronic
998752861 5:145342237-145342259 TCTTTTGAACCTTTTTTTGTGGG - Intergenic
999336496 5:150722570-150722592 TATTTTTAAATTTTTTTTGAAGG + Intronic
1000669016 5:164036910-164036932 GGTTTTGAAACTTCTTTTTAAGG + Intergenic
1000992770 5:167927965-167927987 TTTTTTGAAATTATTTTGGTAGG + Intronic
1202772778 5_GL000208v1_random:27169-27191 AGTTTTGAAACACTTTTTGTGGG - Intergenic
1003001636 6:2341017-2341039 TGTTTTGTAACTATTGTAAATGG - Intergenic
1003297125 6:4840159-4840181 TTTTTTTCAACTATTTTTAAAGG + Intronic
1003314647 6:5001542-5001564 TTGTTTGAAACTATTTCAGAGGG - Intronic
1003510322 6:6774031-6774053 TTATTTGAAATCATTTTTGATGG + Intergenic
1003604141 6:7543290-7543312 TGTTTTGCAAGCAGTTTTGAAGG + Intronic
1003785660 6:9483919-9483941 TGTTTTGGAACTAGCTTTGTTGG + Intergenic
1003835664 6:10070050-10070072 TGTTTTGAAATTATTTTAAATGG + Intronic
1003932426 6:10938157-10938179 AGTTTTGCTAGTATTTTTGAGGG - Intronic
1004101406 6:12615924-12615946 TTTTTTGAGTCTATTTGTGATGG - Intergenic
1004166237 6:13259097-13259119 TGTTTTGGCACTCATTTTGATGG + Intronic
1004226983 6:13794464-13794486 TGTTTTGCTACTAGTTATGATGG - Intronic
1004783311 6:18936887-18936909 AGTGTTGGAACTATATTTGAAGG + Intergenic
1004802581 6:19166800-19166822 TGTTTTTAAAGTATTTTTAATGG + Intergenic
1004818272 6:19336232-19336254 GTTTTTGCAACTACTTTTGATGG - Intergenic
1005158547 6:22835488-22835510 TTTTTTGAAATTACTTTTGTAGG - Intergenic
1005676540 6:28161345-28161367 TGTTTTGAAAATATTGTTCTTGG + Intergenic
1006092893 6:31638471-31638493 TGCTCAGAAACTTTTTTTGATGG + Intergenic
1006153156 6:32000126-32000148 TGTTCCAAAACTTTTTTTGAAGG - Intronic
1006159464 6:32032863-32032885 TGTTCCAAAACTTTTTTTGAAGG - Intronic
1006529416 6:34638365-34638387 TGTATGGAAAATATTTTAGAAGG - Intronic
1006548589 6:34801377-34801399 TGTTAGGGAACTATATTTGAAGG + Intronic
1007007999 6:38385740-38385762 TGTTTTTAAAAAATTTTTGTAGG - Intronic
1007047069 6:38786966-38786988 TGTTTTCTAATTATTTTTGAAGG + Intronic
1007558326 6:42784119-42784141 TTTTTTGAAACTTTTTTTGTTGG + Intronic
1007885665 6:45226827-45226849 TTTTTTTAAAATATTTTTGTTGG - Intronic
1008031094 6:46695317-46695339 TATTTTGAAAGCATTTTTAAGGG - Intronic
1008152283 6:47968644-47968666 TGTTTTCAAACTATTTGAAAGGG - Intronic
1008169359 6:48183514-48183536 TTATTTGACACTATTTTTGTAGG + Intergenic
1008827579 6:55716246-55716268 TGTTCTGAAATTATTGGTGATGG - Intergenic
1009521234 6:64684308-64684330 TTTTTTAAAAATATTTTTGATGG - Intronic
1009745067 6:67801126-67801148 TGTTTTAAAGGTATTTTTGCTGG - Intergenic
1009794256 6:68446815-68446837 TATTTTCAAACTATTTTTGTAGG + Intergenic
1010008522 6:71023684-71023706 TTTTTTGAAATTATGTCTGATGG + Intergenic
1010045433 6:71437442-71437464 AGTTTGGAAAATATTTTTGGGGG + Intergenic
1010101619 6:72115863-72115885 TATTTTAAAGATATTTTTGAAGG - Intronic
1010167993 6:72939936-72939958 TGTTTTGTAACTAAATGTGAAGG + Intronic
1010253527 6:73732963-73732985 TGTTTTGGAACTATGAGTGAGGG + Intronic
1010257778 6:73779005-73779027 TGTTTTGGAAATATTGGTGATGG - Intronic
1010290998 6:74137764-74137786 TCTTTTGTAATTATTTTTGAAGG + Intergenic
1010392204 6:75350244-75350266 TGTTTTAAAATAATTTTTTATGG - Intronic
1011037898 6:82997902-82997924 TGATTTGAAATTATTTTACAAGG + Intronic
1011039846 6:83017484-83017506 GCTTTTGAGACTCTTTTTGAGGG - Intronic
1011240849 6:85269727-85269749 TGTTTTGAAACTCTTATGAAAGG + Intergenic
1011842679 6:91521317-91521339 TGTTTTGAAAATAGTGGTGATGG - Intergenic
1012521415 6:100125929-100125951 GGTTTTCAAACTTTTTTTAAAGG + Intergenic
1012574859 6:100781707-100781729 TGTTTTGAAACTACCTTTTTTGG - Intronic
1012761136 6:103303756-103303778 TGTTTTTCAACCATTTTTAATGG - Intergenic
1013004931 6:106063561-106063583 TTTTTAGAAATTATTTTTAAAGG - Intergenic
1013259342 6:108425112-108425134 TATGTAGAAACTCTTTTTGAGGG + Intronic
1013532888 6:111036177-111036199 TTTTTAAACACTATTTTTGATGG + Intergenic
1013785041 6:113769729-113769751 TGTTTTTAAACTTTTCTTTAAGG - Intergenic
1013959604 6:115883301-115883323 TGTTTAGAATCTATTTTTCTGGG - Intergenic
1014120574 6:117720916-117720938 TCTTTTAAGACTATTTGTGATGG - Intergenic
1014181724 6:118391877-118391899 TCTTTTGATTCTATTTCTGAAGG + Intergenic
1014221370 6:118802155-118802177 TGTTTTAAAAATATTTTTCTGGG + Intergenic
1014278087 6:119409968-119409990 TGTTTTGATAATATTTTAAATGG - Intergenic
1014382929 6:120766411-120766433 TGTTTTGACACTTGTTTTTAGGG + Intergenic
1014566698 6:122957500-122957522 AGTTTGGAAAGTATATTTGAGGG + Intergenic
1015083741 6:129262177-129262199 TGTATTGAAAATATTTTTGAAGG - Intronic
1015602551 6:134924468-134924490 TGTTTTGAAACAATTATTATTGG - Intronic
1015622302 6:135143829-135143851 TGTTATAAAGCAATTTTTGAAGG + Intergenic
1015822412 6:137278762-137278784 TGTTTTAAAAATATTCTAGAGGG - Intergenic
1016092077 6:139992412-139992434 TGTTTTGCAATTGTTTTTCAAGG - Intergenic
1016192495 6:141288404-141288426 TCTTTTGTAACTGTTTTTGGTGG + Intergenic
1016308491 6:142708804-142708826 AGTTTTGAAAATAGTTGTGATGG + Intergenic
1016607445 6:145947751-145947773 TTTATTGAAACTATATTTTAGGG + Intronic
1016648473 6:146436980-146437002 TGTTTTAAAATAATTTTTAAAGG - Exonic
1017556162 6:155571861-155571883 TGTTTGGAAAGCATGTTTGATGG - Intergenic
1018045572 6:159963236-159963258 TGTTTTGCAACTCTTTTTATTGG + Intergenic
1018069623 6:160152299-160152321 ATTTTTGAAAGTATTTTTGCTGG - Intronic
1018139738 6:160818674-160818696 ATTTTTGAAACTTTTTTTCAAGG - Intergenic
1018161364 6:161046584-161046606 TGGTTTAAAACCTTTTTTGATGG + Intronic
1018321137 6:162610026-162610048 TGTTTTGAAATCATTTGAGATGG + Intronic
1018331972 6:162739541-162739563 TGTTTTTAAAAAATTTTTGTCGG + Intronic
1018359238 6:163049675-163049697 CCTTTTAAAGCTATTTTTGAAGG - Intronic
1018373877 6:163193342-163193364 TGTTTTAAATTTGTTTTTGAGGG + Intronic
1018751645 6:166811707-166811729 TGTTTTGAACTTATTTTAAAAGG - Intronic
1018783128 6:167086906-167086928 TGACATGAAACTATTTTTTAAGG + Intergenic
1019041912 6:169112904-169112926 TCTTTTAAAACTAGTTTTGTTGG - Intergenic
1019531940 7:1507786-1507808 CTTTTTGAAAATATTTTTTATGG + Intergenic
1019654937 7:2187091-2187113 TATTATGAAAATAGTTTTGATGG - Intronic
1020155100 7:5716633-5716655 TGTTTTGTCAGCATTTTTGATGG - Intronic
1020775436 7:12448629-12448651 ACTTTTGTAACTATTTTAGATGG - Intergenic
1020881963 7:13773700-13773722 TCTTTTGAAACAGTTTTTAAAGG + Intergenic
1021156157 7:17213159-17213181 TGTTATGAAAATAATTTGGATGG - Intergenic
1021326974 7:19284026-19284048 TGTTTTGAAGTTTTTTTTAAAGG + Intergenic
1021387391 7:20048251-20048273 AGATTTGAAGATATTTTTGATGG + Intergenic
1021414703 7:20369147-20369169 TGTTTTGAAAATCCTGTTGAAGG - Intronic
1021480927 7:21115866-21115888 TGTTTTGAATCTCATTTTAAGGG + Intergenic
1021537637 7:21723418-21723440 TGATTTGAAACTTGTTTTGGAGG - Intronic
1022181524 7:27925295-27925317 AGATTTGAAATTATCTTTGAAGG + Intronic
1022653404 7:32297539-32297561 TGTTTTGAAACTACTTGTGAGGG - Intronic
1023347179 7:39283030-39283052 TTTTTTGGAACTATTGTTAACGG + Intronic
1023413692 7:39912278-39912300 AGTTTGGAAAATATATTTGAAGG + Intergenic
1024208854 7:47186673-47186695 TATTTTGAAGCAATATTTGATGG - Intergenic
1024441836 7:49428674-49428696 TGTTTCAAAATTCTTTTTGAGGG + Intergenic
1024470900 7:49768184-49768206 TGCTTTGAAACCATCTTTGAGGG - Intergenic
1024536771 7:50441517-50441539 TGTTGTAAAAGTATTTTTTAAGG + Intergenic
1025494884 7:61189084-61189106 AGTTTTGAAACACTTTTTAAAGG + Intergenic
1025505512 7:61422801-61422823 AGTTTTGAAACACTTTTTAAAGG + Intergenic
1025534333 7:61929470-61929492 CGTTTTTGAACTATTTGTGAAGG + Intergenic
1025564418 7:62414986-62415008 TGATTTGTTACTATTTTTTAAGG - Intergenic
1025568756 7:62527751-62527773 AGTTTTGAAACTGTTTTTGTAGG + Intergenic
1025588291 7:62821589-62821611 TGTTTTGACAGAATTCTTGAAGG + Intergenic
1026370432 7:69692934-69692956 TGTTTATAAATTAATTTTGAGGG - Intronic
1026506440 7:70988578-70988600 TTTTTTGAAACATTTTTTGGGGG + Intergenic
1026560962 7:71448830-71448852 TATTTTTAAACTATTTATTAAGG - Intronic
1027053670 7:75035616-75035638 TGTTTTGACATTATTTATAATGG + Intronic
1027338888 7:77184270-77184292 TGTTTTGAAAATATGTCTGCAGG + Intronic
1027582494 7:80016274-80016296 TGCTGAGAAACTAATTTTGAAGG - Intergenic
1027682675 7:81240111-81240133 TGTTCTTAAAGTATTTTTGAGGG + Intergenic
1027755493 7:82205598-82205620 TGGATTGTAACCATTTTTGACGG - Intronic
1027880090 7:83823615-83823637 TGTTATGAAAGTATTTTTTAAGG + Intergenic
1028184480 7:87766823-87766845 TGTTTGGAAAAAATATTTGAGGG - Intronic
1028197272 7:87921505-87921527 TGTTTGGAAAATTTATTTGAGGG + Intergenic
1028278554 7:88891252-88891274 TGTGTTGAGACTATATTTGTAGG + Intronic
1028307807 7:89288651-89288673 TATTTTTACAATATTTTTGAAGG - Intronic
1028723741 7:94063294-94063316 TGTTTTTAGACTAATTTTGCAGG + Intergenic
1028809152 7:95063891-95063913 TGTTTTGAAATTATGTGTGGGGG + Intronic
1028935452 7:96458985-96459007 GGTTTTGAAATTATTATTTAAGG + Intergenic
1028949494 7:96619231-96619253 TTTTTTGAAATTGTTTTTGTAGG + Intronic
1029272073 7:99383159-99383181 TGTAATGATAATATTTTTGAGGG + Intronic
1030324253 7:108203272-108203294 TGTTTTAAAACTATTTTAGGTGG + Intronic
1030422476 7:109325492-109325514 TCTTTTGAAACTATTTGGGGAGG - Intergenic
1030430676 7:109443532-109443554 TCTTTTGTTGCTATTTTTGAAGG - Intergenic
1030537138 7:110782528-110782550 TTTTTTGTAACTGTTTTTGATGG + Intronic
1030573707 7:111259633-111259655 TGTTTTAAAATTATTTTTTAGGG - Intronic
1030733873 7:113020967-113020989 AGTTTTGTAACTCTTTTTGTTGG - Intergenic
1031257544 7:119473949-119473971 TTTTTTGGAATTGTTTTTGAAGG - Intergenic
1031686885 7:124741386-124741408 TTTTCTGAAAGAATTTTTGAAGG - Intergenic
1031772889 7:125867896-125867918 TGGTTAGAGACTATTCTTGATGG + Intergenic
1032958897 7:137006844-137006866 TGTGTTGAAAGTATTCTAGAGGG - Intronic
1033019806 7:137712756-137712778 TTATTTGAAACTAAGTTTGATGG + Intronic
1033351196 7:140563539-140563561 TCTTTTTAAACTTTTTTTGTGGG - Intronic
1033633528 7:143185720-143185742 AATATTGAAGCTATTTTTGAAGG - Intergenic
1033690500 7:143731821-143731843 AGTTTTGAAACAATTTCTTAGGG + Intergenic
1033774763 7:144596437-144596459 TGTTTTGATCCTATTATTAATGG - Intronic
1033860869 7:145625185-145625207 TGTTTTAAATAGATTTTTGAAGG + Intergenic
1033869946 7:145740098-145740120 TATTTAGAAATTATTTTTAAAGG - Intergenic
1034153540 7:148936009-148936031 TTTTTTCCAAATATTTTTGATGG + Intergenic
1034674328 7:152881770-152881792 TGTATTGAAACTACTGTTGCTGG - Intergenic
1035795996 8:2357129-2357151 TTTTTTAAAACCATTTTTGAAGG + Intergenic
1036058502 8:5288038-5288060 TCTTTTGAAACTATTTTATTTGG + Intergenic
1036403877 8:8436695-8436717 ATTTTTGAAACCATGTTTGAAGG + Intergenic
1037748668 8:21665868-21665890 TGTTTAAACACTATTTTTGGAGG - Intergenic
1038079158 8:24113239-24113261 TGTTTGGAAACCATTTTAAATGG - Intergenic
1038360848 8:26874602-26874624 TGTTTTGTCACTTTTATTGATGG + Intergenic
1038837493 8:31143505-31143527 TTTTTTGAAACTTTTTTTAATGG + Intronic
1039293260 8:36121702-36121724 TGTTTAGAAATAATTTGTGAGGG - Intergenic
1039394365 8:37211268-37211290 TATTTTGAAAGTAGTTTTGCTGG - Intergenic
1039437006 8:37566626-37566648 TGTTTAGAAAATATTTCTCATGG + Intergenic
1040619908 8:49080099-49080121 TGTTTTAAAATTCTTTTTCAGGG + Intergenic
1040873464 8:52125050-52125072 TGCTTTGGAACGATCTTTGATGG + Intronic
1041150466 8:54926981-54927003 TGTTTAGAAAACATATTTGAGGG + Intergenic
1041781751 8:61584883-61584905 GGTTTTGAACTTATTGTTGAAGG - Intronic
1041898352 8:62952686-62952708 AGTTTTGAAAGTTTTTTTGGAGG - Intronic
1042995668 8:74694890-74694912 TGTTTGGAAAACATATTTGAGGG + Intronic
1043008414 8:74850087-74850109 TGCTATAAAATTATTTTTGAAGG + Exonic
1043517638 8:81010270-81010292 TGTTTTGAATCTATTCCAGAGGG + Intronic
1043672004 8:82898007-82898029 TTTTTTGCAACTATTTTAAAAGG + Intergenic
1043707665 8:83372827-83372849 TGTTTTGAAAGTATATTAGTAGG + Intergenic
1043924893 8:86025783-86025805 TGTTTTGAAAAATTTTTTGTAGG - Intronic
1044063945 8:87675217-87675239 TGTTTTGAGATTATCTTTTAAGG + Intergenic
1044106988 8:88221573-88221595 TGTTTAAAAACTATTTTTTTTGG - Intronic
1044217422 8:89628621-89628643 TGTTTTTAAACTTTTTATTATGG + Intergenic
1044234396 8:89813797-89813819 TGTTTTGAAAGTTCTTTTTATGG - Intergenic
1044284087 8:90391490-90391512 TGTTTTCAAACTATATTACAAGG + Intergenic
1044381588 8:91540643-91540665 TGTTTTGAAATAATTTGAGAAGG + Intergenic
1045180820 8:99780097-99780119 TGTTTTAAAAATATTTTTTAAGG + Intronic
1045210410 8:100092219-100092241 TGTTATGAAACTGTTTTCCAGGG - Intronic
1045753948 8:105519769-105519791 TGTGTTGACATTACTTTTGATGG + Intronic
1046409556 8:113821991-113822013 TGTTCTAAACATATTTTTGAAGG + Intergenic
1046420240 8:113972559-113972581 TGTCATGAAACTATTCTTGATGG + Intergenic
1046635592 8:116671983-116672005 TATTTTTAAACTATTTTTAAGGG - Intronic
1046757032 8:117982658-117982680 TTTTTTAAAAATATTTTTGGTGG + Intronic
1046894908 8:119462358-119462380 CTTTTTAAAAATATTTTTGAAGG - Intergenic
1046927277 8:119805403-119805425 TTTTTTAAAAATATTTTTCATGG + Intronic
1047166267 8:122441878-122441900 TGTCTTTAAATTATTTTTGTTGG - Intergenic
1048361236 8:133698747-133698769 TGTTTTTAAACTAGTTTGAAAGG + Intergenic
1048602642 8:135934470-135934492 TGAATTGAAACAAATTTTGATGG + Intergenic
1048789751 8:138089611-138089633 TGTTTTCATACTTTTTTTGGTGG - Intergenic
1048932029 8:139322802-139322824 TGTTTTGACAATTTTCTTGATGG - Intergenic
1050157748 9:2685520-2685542 TATTTTTAAAATATTTTTAATGG + Intergenic
1050698357 9:8305432-8305454 TTTTTTGAAAATATTTGAGAAGG + Intergenic
1050800786 9:9610259-9610281 TTTTTTGAAAATATGTTTAATGG - Intronic
1050925365 9:11257118-11257140 TGTTTTGAGCATATTTTTAAGGG + Intergenic
1051644653 9:19255694-19255716 TATTTTGAAACTGTTATTAAAGG - Intronic
1051929601 9:22368547-22368569 AGTTTGGAAAATATGTTTGAGGG + Intergenic
1051997182 9:23232104-23232126 TTTTTTGAAAGTAATTTTGAAGG - Intergenic
1052467339 9:28846041-28846063 TGTTTTGTCATTATTTCTGATGG - Intergenic
1052664353 9:31475279-31475301 TGTTTTCAAATTATTTTTTATGG - Intergenic
1053649032 9:40144580-40144602 TGTTTTTAAACTAATTTTATAGG + Intergenic
1053716945 9:40906472-40906494 TGTTCTGTAACTATATGTGAGGG - Intergenic
1053756709 9:41319281-41319303 TGTTTTTAAACTAATTTTATAGG - Intergenic
1053936495 9:43161094-43161116 AGTTTGGAAAATCTTTTTGAAGG + Intergenic
1054075718 9:60527074-60527096 TGTTCTGTAACTATATGTGAGGG + Intergenic
1054330010 9:63742516-63742538 TGTTTTTAAACTAATTTTATAGG + Intergenic
1054421893 9:64944352-64944374 AGTTTGGAAAATCTTTTTGAAGG + Intergenic
1054535549 9:66231593-66231615 TGTTTTTAAACTAATTTTATAGG - Intergenic
1054604221 9:67158511-67158533 TGTTTTCAAGCTTTTTTAGAAGG - Intergenic
1054768235 9:69060634-69060656 GATCTTGAAACTATTTTGGAAGG - Intronic
1054829244 9:69605124-69605146 TTTATTGAAAATATTTTTAAAGG - Intronic
1054863961 9:69980937-69980959 TGTTTTGAACATTTTTTAGAAGG + Intergenic
1054882086 9:70154812-70154834 TGTTTTGGAACTTTTTATGATGG + Intronic
1055184769 9:73437778-73437800 TGTTTTTAAAATCTTTTTAAAGG - Intergenic
1055255215 9:74361810-74361832 AGTTTTAAAAATGTTTTTGAGGG - Intergenic
1055724059 9:79208658-79208680 TGTTTTTAAACATTTTTTGTTGG - Intergenic
1056106015 9:83347067-83347089 TTATTTGAAACTATTTTTCATGG - Intronic
1056881835 9:90401898-90401920 TGTTTTAAAAATATTTTTCTAGG - Intergenic
1057378772 9:94549126-94549148 TGTTTTGATACTATTATAAATGG + Intergenic
1057983351 9:99684396-99684418 TGTTCTAAAAAGATTTTTGATGG - Intergenic
1058317275 9:103584354-103584376 TCCTTTGAAAATATTTTTGTAGG + Intergenic
1058783844 9:108366161-108366183 CATCTTGAAACTATTTTTAAAGG - Intergenic
1058832034 9:108826449-108826471 TGTTTTGATAAAATTGTTGAGGG + Intergenic
1059087099 9:111315936-111315958 TTTTTTGAAATAATTTTAGAGGG - Intergenic
1059773958 9:117455984-117456006 AATTTTGAAACTATTTATCAAGG - Intergenic
1061528254 9:131187130-131187152 TGATTTGACATTTTTTTTGAAGG - Intronic
1061532031 9:131221850-131221872 AGTTTTCAAACTTTTTTTGGGGG - Intronic
1061643938 9:131983825-131983847 TGTTTTGTAAATTGTTTTGAGGG - Intronic
1202796796 9_KI270719v1_random:127880-127902 TGTTTTTAAACTAATTTTATAGG + Intergenic
1203372718 Un_KI270442v1:324832-324854 AGTTTTGAAACTCTTTTTGTAGG + Intergenic
1203413685 Un_KI270589v1:25109-25131 AGTTTGGAAACTCTTTTTGTAGG - Intergenic
1185767852 X:2740349-2740371 AGTCTTAAAACTATTTTGGAGGG - Intronic
1186118382 X:6329501-6329523 TGATTTGAAGATATTTTTGCTGG - Intergenic
1186168609 X:6853762-6853784 TGTTTTTAAATTTTTTTTTAAGG + Intergenic
1186600616 X:11033276-11033298 TGTGTTGCACCCATTTTTGATGG - Intergenic
1187479416 X:19641368-19641390 TGTTCTGAACATACTTTTGAAGG + Intronic
1188189345 X:27155818-27155840 TCTATTTAAACTAGTTTTGAAGG + Intergenic
1188337400 X:28954175-28954197 TATTTTAAAACTCATTTTGAAGG - Intronic
1188438324 X:30188444-30188466 TGTCTTAAAATTATTTTTAAAGG - Intergenic
1188935353 X:36169005-36169027 TTTTTTAAAAATTTTTTTGAAGG + Intergenic
1189567347 X:42256213-42256235 AGTTTGGAAAATATATTTGAAGG + Intergenic
1189668426 X:43381995-43382017 AGTTTTGAAAATATATTTGCAGG + Intergenic
1189828672 X:44947732-44947754 TATTTTAAAACTGTTCTTGAAGG - Intronic
1189990903 X:46593989-46594011 GTTTTTAAAATTATTTTTGATGG - Intronic
1190034471 X:47008595-47008617 TGTTTTGACAAAATTTTTAAAGG + Intronic
1190074448 X:47306113-47306135 GGTTTTAAAACCATATTTGATGG - Intergenic
1190248923 X:48707803-48707825 TGTTGAAAAACTATTTCTGAAGG - Exonic
1190272605 X:48877906-48877928 GGTTTTTAAACCATATTTGATGG + Intergenic
1191041210 X:56082000-56082022 TGTTTTGAAACAGTTTGAGATGG + Intergenic
1191655649 X:63596028-63596050 TGTTTTTAAACTTTTTTTTTAGG + Intergenic
1191877587 X:65811893-65811915 TGGTTTTAAACCATTTCTGAAGG - Intergenic
1192041276 X:67624463-67624485 AGTTTTGAAATAATTTGTGAAGG - Intronic
1192673878 X:73174604-73174626 AGTTTGGAAATTATATTTGAGGG - Intergenic
1192708463 X:73553980-73554002 TATTTTTAAACTATCTTTGGTGG - Intergenic
1192918377 X:75679191-75679213 TGACTTCAAACTATATTTGAAGG + Intergenic
1193163054 X:78250346-78250368 TGTTTTGAAATAGTTTTTGGAGG + Intergenic
1193366411 X:80638918-80638940 AGTTTTGAAAACATTTTTGAGGG + Intergenic
1193502379 X:82295181-82295203 TATTTTAAAACTATTTTTAAAGG + Intergenic
1193548783 X:82862927-82862949 TAATTTAAAAATATTTTTGAAGG + Intergenic
1193582019 X:83277014-83277036 AGGATTGAAGCTATTTTTGAAGG - Intergenic
1193584153 X:83300180-83300202 TGTATTGAAACTATTCCTTAGGG - Intergenic
1194237337 X:91400341-91400363 AGTTTGGAAAATATATTTGAGGG + Intergenic
1194330298 X:92575705-92575727 TGTTCTGAAAATATATTTGTTGG - Intronic
1194464113 X:94210325-94210347 TGTTTTGAAAGAATTTGAGAAGG + Intergenic
1194510254 X:94784645-94784667 TGTTTTGTAATTAATTTTGGGGG - Intergenic
1194588277 X:95764977-95764999 TTATTTAAAACTATTTATGACGG - Intergenic
1195591762 X:106637118-106637140 TGTTTTGATCCTATTATTGGAGG - Intronic
1195794857 X:108634764-108634786 TGTTTTGATAACATTTTTAAAGG + Intronic
1195824855 X:108988637-108988659 TGTTTGGAGACTATTTTTGCTGG + Intergenic
1195877937 X:109561842-109561864 TGTTTTGAAAGTATCATTGGTGG - Intergenic
1196145450 X:112311709-112311731 TGCTTTGAAACCATTTCTGTAGG + Intergenic
1196396153 X:115263506-115263528 TATTTAGAAGCTATTATTGATGG + Intergenic
1197012921 X:121589060-121589082 CATTTTGAAACTTTTTCTGAAGG + Intergenic
1197033524 X:121847813-121847835 TAATTTAAAACAATTTTTGAGGG - Intergenic
1197081611 X:122425318-122425340 TGTTTGGAAAACATATTTGAAGG - Intergenic
1197367736 X:125585059-125585081 TGTTTTAAAACAAATTTTGTTGG - Intergenic
1197670316 X:129270007-129270029 TTTTTTGAGACTAATTTTGTGGG + Intergenic
1198049364 X:132933856-132933878 GGTTTTGAAAATACTTTTGCTGG - Intronic
1198195771 X:134360014-134360036 TTTTTTGGAAGTATTTGTGAAGG - Intergenic
1198232744 X:134707753-134707775 TTTTTTAAAATTATGTTTGATGG + Intronic
1198326648 X:135580444-135580466 AATTTTGAAATTATTTTTGCTGG + Intronic
1198489155 X:137121536-137121558 AATTTTTAAACTATTTTTGGTGG - Intergenic
1199373154 X:147075015-147075037 TGTTTTCAAACTTTTTAAGAAGG + Intergenic
1199517623 X:148695798-148695820 TGTTTAGAAATTATTATTGTGGG + Intronic
1200302546 X:154992332-154992354 TGTTTTTATCCTATTTTTTATGG - Intronic
1200338073 X:155373356-155373378 TGTTCTGCATCAATTTTTGATGG - Intergenic
1200348396 X:155467338-155467360 TGTTCTGCATCAATTTTTGATGG + Intergenic
1200568400 Y:4797562-4797584 CATTTTGAAACAATTTTTAAGGG - Intergenic
1200639008 Y:5694875-5694897 TGTTCTGAAAATATATTTGTTGG - Intronic
1200853680 Y:7913081-7913103 TATTTTGAACTTATTTTAGATGG - Intergenic