ID: 991344720

View in Genome Browser
Species Human (GRCh38)
Location 5:65651627-65651649
Sequence CTGGTTTAGCACATTTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991344717_991344720 0 Left 991344717 5:65651604-65651626 CCATCAAAAATAGTTTCAAAACA 0: 1
1: 0
2: 10
3: 88
4: 841
Right 991344720 5:65651627-65651649 CTGGTTTAGCACATTTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991344720 Original CRISPR CTGGTTTAGCACATTTATGT GGG Intronic
No off target data available for this crispr