ID: 991346209

View in Genome Browser
Species Human (GRCh38)
Location 5:65671490-65671512
Sequence AGTTTCTCTAGCCATTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991346204_991346209 4 Left 991346204 5:65671463-65671485 CCTTAGTAAGTCACTAACCTGTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 991346209 5:65671490-65671512 AGTTTCTCTAGCCATTGGGTAGG 0: 1
1: 0
2: 2
3: 14
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991346209 Original CRISPR AGTTTCTCTAGCCATTGGGT AGG Intronic
902889684 1:19433261-19433283 AATTTCTCGTGCCATTGAGTGGG - Intronic
903264009 1:22145700-22145722 AGTTTCTGTATCCATCAGGTGGG + Intergenic
904612289 1:31732320-31732342 AGTTTTCCTAGCCATCAGGTGGG - Intronic
905485871 1:38296131-38296153 AGTTTCTCTAACCATTAGGAAGG + Intergenic
906801962 1:48745723-48745745 ATTATCTCTAGCCCTTGGCTTGG + Intronic
907246482 1:53112506-53112528 AGTTTCTTTAGACAGTGGGTGGG + Intronic
910838378 1:91538182-91538204 ACTTACGCTAGACATTGGGTGGG - Intergenic
912705509 1:111909015-111909037 AGTTTCTATAGGCATCAGGTGGG + Intronic
913007312 1:114647497-114647519 GGTTTCTCAAGCCATTTAGTTGG + Intronic
921168378 1:212523955-212523977 ATTTTCTCTTGCCAGTCGGTTGG - Intergenic
922410979 1:225374868-225374890 AGTTTCTCCAGTGATGGGGTAGG + Intronic
923208153 1:231778259-231778281 AGTTCCTCTAGCCCTGGGGCGGG - Intronic
924855934 1:247875080-247875102 GTTTTCTCTGGCTATTGGGTTGG - Intronic
1075472202 10:122699536-122699558 GGTTTCTGTAGCCACTGGGTAGG + Intronic
1078989678 11:16633829-16633851 AGTTTCTCTTGCCTTTGATTGGG - Intronic
1080718104 11:34823640-34823662 AGTTGCTCTGGCCATTTTGTAGG + Intergenic
1090054499 11:123410904-123410926 ATTTTCTCAAACCATTAGGTAGG - Intergenic
1091823829 12:3494650-3494672 AGATACTCTAACCATTGGGCAGG + Intronic
1092459751 12:8675941-8675963 ATTTTCTCTAGTCATTGTGCAGG + Intergenic
1093288782 12:17298288-17298310 AGTCTCTCTTCCCAGTGGGTGGG - Intergenic
1098405760 12:70124122-70124144 AGTTTCCCTAGGCTTTGGGCCGG - Intergenic
1099034761 12:77572458-77572480 AATTTATCTATCCAGTGGGTTGG + Intergenic
1100354952 12:93820266-93820288 AGGTTTTCTAGCCATGGGGCAGG - Intronic
1100605497 12:96149109-96149131 AGTTTCCCATTCCATTGGGTTGG + Intergenic
1101196764 12:102391657-102391679 AGTATCTCTAGCCATAGGGATGG - Intergenic
1101868711 12:108544415-108544437 AGTTTCTCTTACCATAGAGTGGG + Exonic
1104230355 12:126878442-126878464 AGCTTCTCTAGACAATGGATGGG - Intergenic
1107070686 13:36265536-36265558 AGTTTCTGCAGCCATTAGGCTGG + Intronic
1107226638 13:38057147-38057169 AGTTTCTACAGTCATTTGGTAGG - Intergenic
1110687409 13:78391296-78391318 AGTTTCTCTAGCAATTAGTAAGG + Intergenic
1111232739 13:85364498-85364520 CGTTTCTCTAGAAAGTGGGTTGG - Intergenic
1112735348 13:102409881-102409903 AATTTCTATAGCCATTGAATGGG + Intergenic
1114126090 14:19727686-19727708 AGTTTTTCTAGCTATTCTGTTGG + Intronic
1117029887 14:51657579-51657601 AGTTTCTTTATCCATTTTGTTGG + Intronic
1118716383 14:68563044-68563066 CGCTTCTCTAGCCAGTGGGAGGG + Intronic
1118880314 14:69820021-69820043 AGTGTGTCTAGCCAGTGGGGAGG + Intergenic
1119016592 14:71063154-71063176 TTTTTCTCTAGCCAAAGGGTTGG + Intronic
1122154093 14:99739955-99739977 AGTTTCCCCATCCATTAGGTGGG + Intronic
1127303734 15:57682325-57682347 AGCTTCTCTTGCCATTAGGTGGG - Intronic
1131297914 15:91168370-91168392 AATTTCTCTGGCCAATGAGTAGG + Intronic
1134692383 16:16199328-16199350 AGTTTCTTTAGCCATAGAATGGG - Intronic
1134979465 16:18595348-18595370 GGTTTCTTTAGCCATAGGATGGG + Intergenic
1135829903 16:25763866-25763888 AATTTCTCTAGCTGTGGGGTTGG + Intronic
1138132010 16:54488099-54488121 AGTTTCTCAAGCCATGGGTTTGG - Intergenic
1139098414 16:63734182-63734204 AGTTTCTCTAGCCATTGTTTTGG - Intergenic
1139452465 16:67041621-67041643 AGTTTCTCTAGCCAAAAAGTTGG - Intronic
1140515144 16:75535869-75535891 AGGTTCTCTGGCGATTGGGGGGG - Intronic
1140618415 16:76695705-76695727 AGTTTCTCTAACCATAGCCTGGG + Intergenic
1141544532 16:84756048-84756070 AGTTTCTGCAGCCCTTGGATTGG + Intronic
1141880411 16:86855085-86855107 AGTTTCTCTTGCCTTTGTGCTGG + Intergenic
1143668242 17:8377206-8377228 AGTTTGTATTGCCATTGGATAGG - Intronic
1146862310 17:36313840-36313862 AATTTCTCTAGGGAATGGGTTGG + Intronic
1147092638 17:38117943-38117965 AATTTCTCTAGGGAATGGGTTGG + Intergenic
1147104570 17:38202556-38202578 AATTTCTCTAGGGAATGGGTTGG - Intergenic
1148424922 17:47585903-47585925 AATTTCTCTAGGGAATGGGTTGG + Intronic
1148861854 17:50608675-50608697 AGCATCTCTTGGCATTGGGTGGG + Intronic
1150453902 17:65291905-65291927 AGTTTCTCTAGGAATTGGGGAGG - Intergenic
1153549796 18:6250310-6250332 AGTTTCTCTAGGCATGGTGACGG - Intronic
1158129352 18:54135602-54135624 ACTTTTTCTAGCCTTTGGTTGGG - Intergenic
1161528811 19:4774280-4774302 AGTTTCTAAAGCCATTGAGCAGG - Intergenic
1162637673 19:11983040-11983062 AGTTCCTCATGACATTGGGTGGG + Intergenic
1165964322 19:39562827-39562849 AGTTCCCCTAGGCCTTGGGTGGG + Intergenic
927045604 2:19275162-19275184 AGTTTCTCTAGGAATTGGTGAGG - Intergenic
927362601 2:22253553-22253575 AGGTTCTCTTGCCATTGTGTTGG + Intergenic
935135650 2:100298731-100298753 AGTTTCTTTAACAACTGGGTGGG + Intronic
935207434 2:100908548-100908570 ATTTTCTCTACCCCTTGGGAAGG - Intronic
935417472 2:102834097-102834119 AGTGTTTCCAGTCATTGGGTGGG + Intronic
936518202 2:113195842-113195864 AGTTTCTCTAACTCTCGGGTGGG - Intronic
936810432 2:116393523-116393545 ATTGTGTCTAGCCATTTGGTAGG - Intergenic
943774448 2:191750086-191750108 AGTTTGGCTAGCCTTTGGGAAGG + Intergenic
946625851 2:221611429-221611451 AGTTTCTGTAGCCATGCGGCAGG + Intergenic
946863236 2:224019941-224019963 AGTGTCTCCAGACATTTGGTTGG - Intronic
948072281 2:235137669-235137691 AGATTCTCAAGGCAGTGGGTGGG - Intergenic
948303549 2:236928843-236928865 AGTTCCTCTAACGAATGGGTTGG - Intergenic
948733646 2:239983706-239983728 TGTTTCTCTAGCGATTAGATTGG - Intronic
1172622305 20:36327505-36327527 AGTTTCTCTATCCATCTGCTAGG + Intronic
1173539504 20:43840871-43840893 GGTTTGTGTAGCCACTGGGTGGG + Intergenic
1174181248 20:48676373-48676395 AGGCTCTCTAGGCATTGGGCAGG + Intronic
1180666721 22:17519158-17519180 ATTTTCTGTAGCCAGTGAGTGGG + Intronic
1181489166 22:23250956-23250978 AGTTCCTTTGGCCTTTGGGTGGG - Intronic
1182012733 22:27014223-27014245 AGTTCCTCTATCCCCTGGGTGGG + Intergenic
1183832837 22:40427943-40427965 AGTTTCTCTAGCTACTGGGAGGG + Intronic
1184204854 22:42995485-42995507 AGTTACTCTGTCCATTGGGCAGG + Intronic
949534904 3:4988307-4988329 AGTTTCTCTAACCAGAGGATGGG - Intergenic
952418220 3:33108608-33108630 AGTTTCTCCACCCTTTGGATGGG - Intergenic
953574764 3:44104170-44104192 AGTTGCTGTAGCCATGGCGTTGG + Intergenic
953616787 3:44497797-44497819 TGTTTATCTAGGTATTGGGTTGG - Intergenic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
955825359 3:62940525-62940547 ACTTTCTCTAGGCTTTTGGTAGG + Intergenic
956556984 3:70535128-70535150 ATTTTATCTAGCCTTTGGGTGGG - Intergenic
957014385 3:75045710-75045732 ATTTTCTCTAGTCACTGGCTTGG - Intergenic
957631938 3:82727328-82727350 AGTAACTCTAGACATTGTGTGGG + Intergenic
958146931 3:89637351-89637373 AATAGCTCTAACCATTGGGTGGG - Intergenic
958806089 3:98812376-98812398 ATTTTCTGCTGCCATTGGGTAGG + Exonic
962414406 3:135168981-135169003 AGGTTCTCCAAACATTGGGTGGG + Intronic
964122539 3:153200672-153200694 AGTTTCTTCAGCTATTTGGTTGG + Intergenic
969866738 4:10081251-10081273 AGTTGCTCTAGCCAGTGTTTTGG - Intronic
971601996 4:28604646-28604668 ATTTTCTCTAGCCATTTCTTTGG - Intergenic
972314372 4:37912300-37912322 AGTTTCCCAGGCCAATGGGTTGG + Intronic
976420209 4:84833954-84833976 AGTTTCTCCAGGCATTTGGTGGG - Intronic
977034213 4:91928846-91928868 AGATTCTGTAGTCATTGGATAGG + Intergenic
980960484 4:139470142-139470164 AGTTTCCCTAAGCCTTGGGTTGG + Intronic
984361808 4:178743661-178743683 AATCTCTCTAGCTATTAGGTTGG + Intergenic
990821092 5:59841094-59841116 AGTTTCTCTTGCACTTGGGGTGG + Intronic
991346209 5:65671490-65671512 AGTTTCTCTAGCCATTGGGTAGG + Intronic
992830527 5:80589268-80589290 TGTTGCTCTTGCCATTGGTTGGG - Intergenic
997059906 5:130488574-130488596 AGTTTCCCTAGGCCCTGGGTGGG - Intergenic
997059916 5:130488628-130488650 AGTTTCTCTAGGCCTTGGGTGGG - Intergenic
998063867 5:139140652-139140674 ATTTTCTCTGGGCATTCGGTGGG - Intronic
1003021396 6:2512940-2512962 AGTTGGTTTAGCCATTTGGTGGG + Intergenic
1003456588 6:6288548-6288570 ATTTTCTTTATCCATTGGTTAGG + Intronic
1006060095 6:31412940-31412962 TGTTTCTCCAGCCATCGGGGCGG + Intronic
1011815408 6:91184152-91184174 AGTTTCTCAAGTCACTGGCTTGG + Intergenic
1017318304 6:153058324-153058346 AGTTTTTGTATCCATTGGCTGGG + Intronic
1017817956 6:158028594-158028616 AGGTTCTTGAGCCATTGAGTTGG + Intronic
1018098346 6:160413497-160413519 AGTTTCCCTATCCACTGAGTAGG + Intronic
1018478388 6:164166399-164166421 AGTTATTCAAGCCATTGGGAGGG - Intergenic
1021110309 7:16686415-16686437 AGTTTCTCTAGACCTTGAGAGGG - Intronic
1022130375 7:27399574-27399596 AGCTTCTCTAGCCACAGTGTGGG + Intergenic
1022190191 7:28010177-28010199 AGTCTCTCTTGCCTTTGGTTAGG + Intronic
1022789496 7:33672734-33672756 AGGTTCTGTAGCCATCGGCTTGG - Intergenic
1026601338 7:71780059-71780081 AGTCTGTCCAGGCATTGGGTTGG - Exonic
1031590036 7:123579867-123579889 GGTTTCTCTTGCCATTGTTTAGG + Intronic
1032893917 7:136229519-136229541 AGTTACTTAAGCCATTGTGTTGG + Intergenic
1034708321 7:153168058-153168080 GGTGTCTCTAGCCATTAGGTAGG + Intergenic
1036680857 8:10872216-10872238 ATTTTCTCAAGGCATTGGGTGGG + Intergenic
1041719699 8:60964890-60964912 AATTTCTCTATCCATTAAGTGGG - Intergenic
1042939244 8:74090774-74090796 AGTTTCTCCAGCAATTTGGTAGG + Intergenic
1043039625 8:75245259-75245281 AGTTTCACTATCTATTAGGTTGG - Intergenic
1045395749 8:101759252-101759274 ATTTCTTCTAGCCATTGGCTTGG - Intronic
1045506487 8:102782280-102782302 AGTTTCTGATGCCATTGGGCTGG - Intergenic
1046835079 8:118791538-118791560 GGTTTCTTCAGCCATGGGGTTGG - Intergenic
1047429982 8:124782728-124782750 AGGTCCTCTAGCCTCTGGGTTGG - Intergenic
1051704394 9:19860987-19861009 AGTTCCTCTAGGCCCTGGGTGGG - Intergenic
1056897720 9:90566558-90566580 AGGTTCTCTTCCCAGTGGGTGGG - Intergenic
1060503946 9:124183929-124183951 AGTTCCTCTGACCATTGGGAAGG - Intergenic
1187724183 X:22185534-22185556 AGTTTGTTAAGCCATTGTGTTGG + Intronic
1187727641 X:22220277-22220299 AGTGTCTCTGGCCCTGGGGTAGG - Intronic
1191677959 X:63811272-63811294 GGTTTCTCTACCCATAGGCTTGG + Intergenic
1191905015 X:66078235-66078257 AGATTCACTGGCCATTGGTTTGG - Intergenic
1194372441 X:93090817-93090839 AGTTTCCCTAGGCTCTGGGTGGG + Intergenic
1196326834 X:114415267-114415289 AGTTTTTCTAGCCTTTAGCTTGG - Intergenic
1197288500 X:124625823-124625845 AGCTTCTCTAATCATGGGGTTGG - Intronic
1200680483 Y:6204860-6204882 AGTTTCCCTAGGCTCTGGGTGGG + Intergenic