ID: 991350683

View in Genome Browser
Species Human (GRCh38)
Location 5:65717780-65717802
Sequence CACAGTCATGAATTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991350681_991350683 7 Left 991350681 5:65717750-65717772 CCTGACAGCATTAAAGGTCTACT 0: 1
1: 0
2: 3
3: 12
4: 87
Right 991350683 5:65717780-65717802 CACAGTCATGAATTTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991350683 Original CRISPR CACAGTCATGAATTTAAAGT GGG Intronic
No off target data available for this crispr