ID: 991350738

View in Genome Browser
Species Human (GRCh38)
Location 5:65718230-65718252
Sequence CTGTGCATTAGCAGCATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 2, 1: 1, 2: 5, 3: 16, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991350732_991350738 27 Left 991350732 5:65718180-65718202 CCGCATACTGACATTTTGGATCA 0: 1
1: 0
2: 0
3: 17
4: 200
Right 991350738 5:65718230-65718252 CTGTGCATTAGCAGCATCCATGG 0: 2
1: 1
2: 5
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991350738 Original CRISPR CTGTGCATTAGCAGCATCCA TGG Intronic
903005942 1:20298894-20298916 CTGTGCCATAGCAAAATCCATGG - Intronic
905785515 1:40753806-40753828 CTGCACATTAAAAGCATCCAGGG - Intronic
906127096 1:43433431-43433453 CTGAGCATTAACAACATCTAAGG + Intronic
907467574 1:54649421-54649443 CTGTGCATTAGGAGGAGCCGTGG - Intronic
908143770 1:61216042-61216064 CAGTGCATCAGCACCATGCAAGG - Intronic
910431092 1:87160386-87160408 CAGTACATTAGCAGGATCCCAGG - Intronic
914379514 1:147103951-147103973 CCGTGCATTGGCAGCATCATGGG + Intergenic
915626313 1:157116012-157116034 CTTTGCATCAGCAGGAACCAGGG - Intergenic
915960087 1:160259039-160259061 CTTTTCATTACCATCATCCAGGG - Intronic
918133112 1:181646306-181646328 GTGTGCCTTAGCAGCATTCCTGG - Intronic
922040034 1:221887412-221887434 CTGTTGATTAGCCGCATCTATGG + Intergenic
922131777 1:222787293-222787315 CTATGCATTGGAATCATCCAAGG + Intergenic
923479358 1:234368159-234368181 CTGTGCAGTGCCAGCCTCCATGG - Intergenic
923716024 1:236425395-236425417 CTTTGCCTTAGCAGCAACCAGGG + Intronic
923806926 1:237267703-237267725 CTGCACCTTAGCAGGATCCATGG + Intronic
924017083 1:239738907-239738929 CTGTGCCTTAGCAGTGACCAAGG - Intronic
1063107701 10:3007843-3007865 GTGTGCAATTACAGCATCCAAGG - Intergenic
1063898142 10:10703619-10703641 CTGTACATTAGAACCATCTAGGG - Intergenic
1064169331 10:13016482-13016504 TTGTACATTAGGAGCCTCCAAGG - Intronic
1071028037 10:81139286-81139308 CAGTGCTTTAGCTGCATCCCAGG - Intergenic
1072320365 10:94243645-94243667 CTGAGCATAACTAGCATCCAGGG + Intronic
1073883794 10:108014277-108014299 CTGTGCATTAACAGCATTACAGG + Intergenic
1078067001 11:8085228-8085250 CTGAGCATTAGAATCACCCATGG + Intronic
1079468570 11:20756696-20756718 TTGTGCATTAACAGCATCCCGGG + Intronic
1079478310 11:20854859-20854881 CTGTGACTTAGCAGCATCCAAGG - Intronic
1080212926 11:29807997-29808019 CTGTCCATTAGCAGAATATAGGG - Intergenic
1081690940 11:45078026-45078048 GTGTGGATTACCAGAATCCAGGG - Intergenic
1082178816 11:49093941-49093963 CTGAGGATTATTAGCATCCAAGG - Intergenic
1082198777 11:49337171-49337193 TTCTGCATTGGCAGCATACAGGG + Intergenic
1083062543 11:59889459-59889481 CACTGCATTAGCTGCATCCCAGG + Intergenic
1085819025 11:79772235-79772257 CTATGCATTAGAATCACCCAAGG + Intergenic
1086657035 11:89370928-89370950 TTCTGCATTGGCAGCATACAGGG - Intronic
1086686458 11:89738892-89738914 CTGAGGATTATTAGCATCCAAGG + Intergenic
1088713340 11:112527526-112527548 CAGAGCATGAGCAGCCTCCATGG - Intergenic
1088984381 11:114892661-114892683 CTGTGGTTTAGCAGCAACCCTGG - Intergenic
1089480206 11:118798484-118798506 CTGGACATTAGGATCATCCAGGG - Intergenic
1090396494 11:126422807-126422829 CTGTGGATTGGGACCATCCAAGG + Intronic
1094473618 12:30824853-30824875 CTGTGCGTTAGAATCATCAAAGG + Intergenic
1094845682 12:34360416-34360438 CTGTGCATACGCAGGGTCCAGGG - Intergenic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1098805805 12:75019242-75019264 TTGTGCATTAACTGCAGCCAAGG + Intergenic
1099970709 12:89497088-89497110 CAGTGCATGAGCAGCAGCCAGGG + Intronic
1103039003 12:117679233-117679255 ATGTGCATCAGCACCATGCACGG + Intronic
1108614086 13:52114431-52114453 TTGTGAATTAGAAGCAACCAAGG - Intronic
1114529733 14:23388278-23388300 CTTGGCATTAACAGCCTCCACGG + Exonic
1114535088 14:23417626-23417648 CTTGGCATTAACAGCCTCCACGG + Exonic
1116525090 14:45894443-45894465 CTGTACATTAGGATCACCCAAGG - Intergenic
1117135305 14:52729980-52730002 CTGTGGCCTAGCAGCATCCGAGG + Intergenic
1117685174 14:58245357-58245379 CTGTGAATCAGCAGCACCCTAGG - Intronic
1118435977 14:65771228-65771250 CCGTGCATGACCAGCATGCAGGG - Intergenic
1119438960 14:74615584-74615606 CTGTGAAGGAGCAGCATCCCAGG - Intergenic
1119490209 14:75025555-75025577 CTGTGGAACATCAGCATCCAGGG - Intronic
1121492056 14:94368074-94368096 CTGGCCAAGAGCAGCATCCAAGG - Intergenic
1122696945 14:103559920-103559942 CTGCGGATCAACAGCATCCAGGG + Exonic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123800899 15:23819410-23819432 CAGTGCATTGGCAGCATCACAGG - Intergenic
1124358166 15:29014070-29014092 TTGTGCTTTATCATCATCCAGGG + Intronic
1127360790 15:58243329-58243351 CTGTGCAATTGCAGCATCCCTGG - Intronic
1129945240 15:79533969-79533991 CTGTGCATTAGCAGCATCCATGG - Intergenic
1130927793 15:88398200-88398222 CTGTGCATCAGAAGCAGCTAGGG + Intergenic
1131077662 15:89505959-89505981 CTGTGCGTTAGCAGCACCCCTGG + Intergenic
1132803446 16:1765157-1765179 CTGTGCATCTCCAGCATCCCCGG + Exonic
1133631455 16:7625940-7625962 CTTTGAATTAGTAGCATCAATGG + Intronic
1138186130 16:54978960-54978982 TTGTGCATTTGAAGAATCCAGGG + Intergenic
1139134226 16:64182099-64182121 GTGAACATTAGCAGCATCCAAGG - Intergenic
1142240748 16:88943776-88943798 CTGTGACTTGGCCGCATCCAGGG - Intronic
1145215460 17:21048279-21048301 CTGTGCATAAACTACATCCAGGG + Intergenic
1146277227 17:31523504-31523526 CTGTGCATGAGCTGCCTGCAGGG - Exonic
1147992158 17:44341142-44341164 CAGTGCATTGGCAGCATCGCAGG + Intergenic
1148445047 17:47732620-47732642 CACTGCATCAGCAGCAGCCAGGG - Intergenic
1149527289 17:57366553-57366575 CTTTGCAAAAGCAGCAGCCAGGG + Intronic
1149570811 17:57671140-57671162 CATTTCATCAGCAGCATCCATGG - Intronic
1150161965 17:62906098-62906120 CTGTGCACTAGAATCACCCAGGG + Intergenic
1152791418 17:82282416-82282438 TTGTGCCCTGGCAGCATCCAGGG + Intergenic
1155563291 18:27103756-27103778 CTGGTCATTAGCAGAGTCCAAGG + Intronic
1158031999 18:52977397-52977419 CTGTGCATTGGCATCACCCTGGG - Intronic
1161615630 19:5268669-5268691 CTGAGCACTAACAGCATCCCAGG + Intronic
1163074119 19:14873841-14873863 TTCTCCATTATCAGCATCCAGGG - Intergenic
1166443193 19:42834156-42834178 CAGTGCATTGGCAGCATCGCAGG - Intronic
1166450981 19:42900559-42900581 CAGTGCATTGGCAGCATCGCAGG - Intronic
1166480162 19:43164882-43164904 CAGTGCATTGGCAGCATCGCAGG - Intronic
1166489987 19:43250429-43250451 CAGTGCATTGGCAGCATCGCAGG - Intronic
1167299465 19:48670664-48670686 CTGTGCCACAGCAGCCTCCAGGG + Exonic
925833896 2:7924097-7924119 CTGTGCATTAGCAGCCCCCAGGG + Intergenic
925989280 2:9240793-9240815 ATCTGCATTACCAGCATCTAGGG + Intronic
927936388 2:27078978-27079000 CTGTGGAGCAGCAGCATCCCCGG + Exonic
928713590 2:34034864-34034886 CTGTGCATTAGAGTCAGCCAGGG + Intergenic
930353806 2:50291882-50291904 CTGTGCATTAGAACCTTACAGGG - Intronic
930595676 2:53385376-53385398 CTGTTCAATAGCAGCAACCTAGG - Intergenic
934682222 2:96292582-96292604 TTGTGCATTCGCATTATCCAGGG - Intronic
936800641 2:116260984-116261006 CAGTGCATTGGCAGCATCGCAGG + Intergenic
947520829 2:230844808-230844830 CTCTGCATTAGTAACATCCCTGG - Intergenic
948660290 2:239502638-239502660 GTGTGCACCACCAGCATCCAGGG - Intergenic
1169302365 20:4455293-4455315 CTGTGCATTAGAATCACCTAGGG + Intergenic
1172408734 20:34707230-34707252 CTGTTCAAGGGCAGCATCCAGGG - Intronic
1176019317 20:62954434-62954456 CTGTGCAGAAGCAGCATCCACGG - Intronic
1179637674 21:42723829-42723851 CTGTGAATTACCAGCATCCCAGG + Intronic
1180881048 22:19203713-19203735 ATGTGCATGGGCAGCCTCCAGGG - Intronic
1181773783 22:25145281-25145303 CTCTGAAATAGCAGCATCAATGG + Intronic
1183320793 22:37163975-37163997 TCGTGCATGAGCAGCAGCCATGG - Intronic
1183721816 22:39567178-39567200 CTGTTCCTTAGCAGCTTCCCAGG - Intergenic
1185209900 22:49564955-49564977 CTGTCCCTCAGCATCATCCATGG + Intronic
949272244 3:2231618-2231640 ATGTACCTTAGCAACATCCAAGG + Intronic
949384406 3:3484107-3484129 CTGTGCATGAACAGGATCAAGGG - Intergenic
949663302 3:6307071-6307093 CTGTGCATTGGCGGCATCACAGG - Intergenic
956698058 3:71935401-71935423 CTGTGCATTAGAAGCACCTGGGG + Intergenic
957677318 3:83384807-83384829 CTGGACACTAGCAGCATCCCTGG + Intergenic
957787029 3:84896537-84896559 CAGTGCATTGGCAGCATCACGGG - Intergenic
962475999 3:135756024-135756046 CAGTGCAATAGCAGCCCCCAGGG - Intergenic
963941182 3:151097740-151097762 GTGAACATTAGCAGCATCCCTGG - Intronic
965973845 3:174596306-174596328 TTATGGATTAGCAGCATCAATGG - Intronic
966259562 3:177959580-177959602 CTGCGCATTAGCAGTAACCAGGG + Intergenic
969067142 4:4494987-4495009 TTGTACATTAGAATCATCCAGGG - Intronic
969596355 4:8151455-8151477 CTGTGGATTAGCAGCTTCTGTGG - Intronic
970552429 4:17195868-17195890 CTGTGCCTTAGCTACTTCCAAGG - Intergenic
972236973 4:37146367-37146389 CTTTGCAGTAGCACCTTCCATGG + Intergenic
975586491 4:75955307-75955329 CAGTGCATTGGCAGCATCGCAGG + Intronic
977511614 4:97969457-97969479 CAGTGCATTGGCAGCATCACAGG + Intronic
980092420 4:128456303-128456325 CAGTGCATTGGCAGCATCCCTGG + Intergenic
980402410 4:132308484-132308506 CAGTGCATTGGCAGCATCGCAGG - Intergenic
982846208 4:160255964-160255986 CAGTGCATTGGCAGCATCGCGGG - Intergenic
984503087 4:180580956-180580978 CTGTGCAGTAGAATCAGCCAGGG + Intergenic
986125161 5:4877730-4877752 CTGTGCATGTGCAGGTTCCAGGG + Intergenic
987060464 5:14238438-14238460 CAGAGCATTCGCAGCCTCCAGGG + Intronic
988168136 5:27620285-27620307 CTGTGCATGTGCAGGATCTAGGG + Intergenic
991350738 5:65718230-65718252 CTGTGCATTAGCAGCATCCATGG + Intronic
992001692 5:72442450-72442472 CTGTACATTAGAAGCATCTGGGG - Intergenic
993894684 5:93519673-93519695 CTGGGCAATAGCAGCAGACATGG - Intergenic
994620116 5:102153213-102153235 CTGTGTAAAAGCAGAATCCACGG + Intergenic
995631893 5:114143090-114143112 CAGTGCATTGGCAGCATCTTGGG - Intergenic
995657162 5:114439605-114439627 CGGTGCATTAGAATCACCCAGGG - Intronic
998237272 5:140408979-140409001 CTGTGCATTAGAAGCATCCCTGG + Intronic
999189375 5:149735218-149735240 CTGATCATTAGCACCAGCCAGGG - Intronic
1001702682 5:173718742-173718764 CTGTGCTGTAGCAGCAGACAGGG + Intergenic
1002467325 5:179414076-179414098 CGGGGCAGCAGCAGCATCCAGGG + Intergenic
1002531484 5:179849014-179849036 CTGTGCCATAGCAGGACCCATGG - Intronic
1002531499 5:179849114-179849136 CTGTGCCATAGCAGGACCCATGG - Intronic
1002531514 5:179849214-179849236 CTGTGCCATAGCAGGACCCATGG - Intronic
1002531529 5:179849314-179849336 CTGTGCCATAGCAGGACCCATGG - Intronic
1002531543 5:179849414-179849436 CTGTGCCATAGCAGGACCCATGG - Intronic
1002531556 5:179849514-179849536 CTGTGCCATAGCAGGACCCATGG - Intronic
1002531564 5:179849564-179849586 CTGTGCCATAGCAGGACCCATGG - Intronic
1002531576 5:179849664-179849686 CTGTGCCATAGCAGGACCCATGG - Intronic
1002531583 5:179849714-179849736 CTGTGCCATAGCAGGACCCATGG - Intronic
1004136147 6:12968938-12968960 CTGTGGATTAACAGAATCCCCGG - Intronic
1004424067 6:15496025-15496047 CTGTTCATCCCCAGCATCCAGGG + Intronic
1005155528 6:22801870-22801892 CTATTCATTACCAGAATCCATGG - Intergenic
1005393118 6:25354002-25354024 CTGTGCATTATCAGAATCCCTGG - Intronic
1006983158 6:38161817-38161839 CTGTGCACCAGCAGCACCCATGG + Intergenic
1007125639 6:39423420-39423442 CTGTGGATTATCAACATTCAAGG - Intronic
1008853398 6:56052080-56052102 CTGTACATTAGAAGCACCTAGGG - Intergenic
1009832496 6:68956121-68956143 CTCTGCATTCGGAGCCTCCATGG - Exonic
1011336287 6:86264651-86264673 CTGTACATTAGCAGCATCCCTGG + Intergenic
1011663428 6:89613463-89613485 CTGTGCTTGAGGAGGATCCAGGG - Intronic
1012306385 6:97663280-97663302 CTGTGCAAGAGCACCATCCTAGG + Intergenic
1012349219 6:98230917-98230939 CTGTGCATTGGAATCACCCAGGG - Intergenic
1015506781 6:133996750-133996772 CTGTGCACAAGCAGGTTCCATGG + Intronic
1018163812 6:161074968-161074990 ATGTGCATTCCCAGCCTCCATGG - Intronic
1018382632 6:163272752-163272774 CAGTGCTTTATCAACATCCATGG + Intronic
1020535298 7:9389201-9389223 CTGTGCTTTAGCAGGAGCCCTGG - Intergenic
1023165495 7:37339299-37339321 CTGTGTACAAGAAGCATCCAGGG - Intronic
1027361023 7:77410036-77410058 CTGTACATTAGAATCACCCAGGG - Intronic
1031131076 7:117833937-117833959 CTGTGAGTAAGCAGCATCTAAGG - Intronic
1031161441 7:118173321-118173343 CTTTGCACCAGCAGCATCCCCGG + Intergenic
1031255235 7:119438637-119438659 CTCTGCATTAGCACACTCCAGGG - Intergenic
1031269036 7:119621375-119621397 CTCTGAATTAGCAGGAACCATGG - Intergenic
1033233601 7:139620733-139620755 CTGTGCATTTGCAACAGGCACGG + Intronic
1034301997 7:150024335-150024357 CTGTGACTTTGCAGAATCCAGGG - Intergenic
1034642514 7:152615418-152615440 CGGTGCGTTGGCAGCACCCACGG - Intergenic
1034804056 7:154072980-154073002 CTGTGACTTAGCAGAATCCAGGG + Intronic
1036563613 8:9919215-9919237 CTGTGCTGATGCAGCATCCATGG - Intergenic
1036604010 8:10290524-10290546 CTTTGCATCAGAAGCACCCATGG + Intronic
1037404239 8:18524371-18524393 ATGTGCAAAAGCAGCAGCCAGGG - Intergenic
1037596900 8:20361806-20361828 ATGTGCACCAGCAGCCTCCACGG - Intergenic
1038069249 8:23995209-23995231 ATGTACATAAGCAGCATGCAGGG + Intergenic
1038437728 8:27548113-27548135 CTGTCAATTAGCAACATCCAAGG + Intergenic
1040664872 8:49620259-49620281 TTGTGTATTTGCAGCTTCCAAGG - Intergenic
1041451885 8:58014251-58014273 CTGTGCATCAGCATCCCCCAGGG - Intronic
1042632465 8:70833610-70833632 CTGTGCATTAGAACCATGTAGGG + Intergenic
1044347917 8:91127817-91127839 CAGAGCAAGAGCAGCATCCAGGG + Intronic
1044989853 8:97786294-97786316 CTTTGCAGTTGCAGCTTCCAAGG + Intronic
1046598946 8:116295599-116295621 CTGCGCATTAGAATCATCTAGGG + Intergenic
1048801132 8:138194533-138194555 CTGTACATTAGAATCATCCTTGG - Intronic
1050273367 9:3970563-3970585 CTGTGCATTAGCAGCATCCTGGG - Intronic
1050571725 9:6947734-6947756 CTGTGCTTTAGAATCATCTAGGG + Intronic
1052342360 9:27376568-27376590 CTGTGCATTAGAATTATCCAGGG + Intronic
1056672324 9:88640948-88640970 CTGTGCATTTACAAAATCCAAGG + Intergenic
1060984999 9:127814872-127814894 CTGAACAGTAGCAGCATCCAGGG - Intergenic
1061404506 9:130385893-130385915 GAGTGGATTAGCAGCTTCCAGGG + Intronic
1061704725 9:132444199-132444221 CTGGGCATTAGCAGCAGCAATGG + Intronic
1062339683 9:136088446-136088468 CTGTGGCTTTGCAGCTTCCAGGG - Intronic
1185706853 X:2273973-2273995 CGATGAATTATCAGCATCCAGGG - Intronic
1186232086 X:7466341-7466363 TGGTGCATTAGTAGCACCCAAGG - Intergenic
1192908053 X:75572694-75572716 CAGTGCATTGGCAGCATCGTGGG + Intergenic
1192950501 X:76011356-76011378 CAGTGCATTGGCAGCATCATGGG + Intergenic
1193737387 X:85175112-85175134 CAGTGCATCAGCATCAACCATGG + Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198647654 X:138827158-138827180 CTGTTCATTAGAAGTTTCCAGGG - Intronic
1199893892 X:152114580-152114602 CTGAGCATGAGCTGCAGCCAGGG - Intergenic
1200858148 Y:7961131-7961153 CAGTGCATTGGCAGCATCACAGG - Intergenic