ID: 991351552

View in Genome Browser
Species Human (GRCh38)
Location 5:65724398-65724420
Sequence TTCGTTTTGAAGCATGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991351549_991351552 20 Left 991351549 5:65724355-65724377 CCTTTTGCGTCTGGTTTATTTAG 0: 1
1: 1
2: 13
3: 113
4: 915
Right 991351552 5:65724398-65724420 TTCGTTTTGAAGCATGTGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991351552 Original CRISPR TTCGTTTTGAAGCATGTGTC GGG Intronic
901230857 1:7641068-7641090 TGCTTTCTGAAGCATCTGTCAGG + Intronic
902866164 1:19281260-19281282 TTCTTTTTCAAGCATGTTTTGGG + Intergenic
903238728 1:21968334-21968356 TATGTCTTGAAGCATGTCTCTGG - Intergenic
903242653 1:21993998-21994020 TATGTCTTGAAGCATGTCTCTGG - Intronic
905044121 1:34983096-34983118 TGCCATTTGATGCATGTGTCTGG - Intronic
911123508 1:94319215-94319237 TTCTTTTTGAAGGATGTGCAAGG + Intergenic
911308023 1:96255609-96255631 TTCATGTTGTAGCATGTGTCCGG + Intergenic
911834988 1:102607078-102607100 TTCTCTTTGAAGCATATCTCTGG + Intergenic
912143223 1:106757329-106757351 GTCTTTTTGAAGGATGTCTCTGG + Intergenic
912779299 1:112529412-112529434 TTCATTAAGAAGCATGTTTCAGG + Intronic
913761709 1:122141412-122141434 TTCCTTTTGATGCATCTGTTTGG + Intergenic
915770089 1:158412112-158412134 TTTGTTTTGATACCTGTGTCAGG - Intergenic
923367390 1:233276155-233276177 TTCATGTTGTAGCATGTATCAGG - Intronic
1063640521 10:7825643-7825665 TTCATGTTGTAGCCTGTGTCGGG + Intronic
1064669274 10:17692779-17692801 TTCCTTTTGGATCAAGTGTCAGG - Intronic
1065043422 10:21721099-21721121 TGCATTTTTAATCATGTGTCAGG + Intronic
1068008234 10:51415723-51415745 TTGGTTTTGTAGCTTGTGTCGGG - Intronic
1069169762 10:65211755-65211777 TTCGTTTTGAAGAATTTGAGAGG - Intergenic
1070737414 10:78872886-78872908 TGAGTTTTGAAGCATGTTTGTGG - Intergenic
1071195972 10:83160268-83160290 TTCATATTGAAGCATCTGACAGG + Intergenic
1072617851 10:97061387-97061409 TTCTTTCTGAAGCATGTAGCTGG + Intronic
1072629084 10:97133190-97133212 TCCCTGTTGTAGCATGTGTCAGG - Intronic
1074092665 10:110276628-110276650 TTCCTTCTCAAGCAAGTGTCTGG + Intronic
1077774243 11:5253968-5253990 TTCGTTTTAAAACATCTATCTGG - Intronic
1079191436 11:18280723-18280745 TCCATGTTGTAGCATGTGTCAGG - Intronic
1080009063 11:27439369-27439391 TCCATTTTGTAGCATGTGTCAGG + Intronic
1080686510 11:34520048-34520070 TAAGTTGTGAATCATGTGTCTGG + Intergenic
1080893930 11:36433402-36433424 TTCATGTTGTAGCATGTGACAGG + Intronic
1081173495 11:39896933-39896955 TTCTTTTTGAAGCAAGTATTAGG + Intergenic
1082022646 11:47547706-47547728 ATCATTTTGTAGCATGTATCAGG - Intronic
1083285680 11:61657179-61657201 TTTTTTTTAAAGCATGTGTGAGG - Intergenic
1083733109 11:64663876-64663898 TTCATGTTGTAGCATGTGTCAGG - Intronic
1089841521 11:121422851-121422873 TTCATGTTGCAGCATGTGACAGG + Intergenic
1093633200 12:21434767-21434789 GTTGTTTTGATGCATGTGTGAGG - Intergenic
1095140141 12:38651799-38651821 TCCTTTATGAAGCATGTCTCTGG + Intronic
1095882944 12:47157947-47157969 TCCATGTTGTAGCATGTGTCAGG + Intronic
1096442280 12:51653479-51653501 TCCATGTTGTAGCATGTGTCAGG + Intronic
1097834070 12:64255982-64256004 TTCTTGTTGCAGCATGTGACAGG - Intergenic
1097997276 12:65902324-65902346 TTAGTTTTGAGGAATGTGCCTGG - Intronic
1098966859 12:76799564-76799586 TGCGTGTTGGAGCATGTTTCTGG + Intronic
1099756220 12:86853330-86853352 TTCGCTTTAAAGCATGTAGCTGG - Intergenic
1100274570 12:93060358-93060380 TTCATATTGTAGCAGGTGTCAGG - Intergenic
1104399444 12:128463631-128463653 TTCTTATTGAAGCATGTCCCTGG + Intronic
1106430258 13:29674201-29674223 TTCACATTGCAGCATGTGTCAGG + Intergenic
1107025616 13:35798338-35798360 TTGGTTTTGAATCATGGATCTGG + Intronic
1107657082 13:42602564-42602586 TTATTTATGAAGCAAGTGTCTGG - Intronic
1108329861 13:49374784-49374806 TATGTTTTGAAGAATGAGTCAGG - Intronic
1109640644 13:65186883-65186905 GTCATTTTCAAGCATGTGGCTGG - Intergenic
1110948075 13:81449588-81449610 TTTGTTTTGAAATATGTTTCAGG - Intergenic
1111660186 13:91200227-91200249 TGCCTTTTGAAGGATGTGTTAGG - Intergenic
1115113166 14:29848770-29848792 GTCGTTTTGAAGTTTTTGTCAGG - Intronic
1116906063 14:50404831-50404853 TTCATGTTGCAGCATGTGACAGG + Intronic
1121100837 14:91249050-91249072 TTCTGTGTGAAGCATGTGTGAGG - Intronic
1121841412 14:97137285-97137307 TCAGTGTTGTAGCATGTGTCAGG + Intergenic
1122081397 14:99270172-99270194 GTCGATTTCAAGCATGTGGCTGG - Intronic
1124462960 15:29909571-29909593 TTCGTTTTGACTCATAAGTCTGG - Intronic
1127657827 15:61071878-61071900 TGAGTTTTGAAGGATGTGTTGGG + Intronic
1128147714 15:65341553-65341575 TCCCTGTTGTAGCATGTGTCAGG - Intronic
1128800474 15:70493770-70493792 TTAGTTTTCAAGCATAAGTCTGG + Intergenic
1129574460 15:76726681-76726703 TCCATGTTGTAGCATGTGTCAGG - Intronic
1133769724 16:8860753-8860775 TTAGATTTGAAGCATGGGCCAGG + Intronic
1139129881 16:64130456-64130478 TTCTTTTTGAAGAATCTGTAAGG + Intergenic
1139152774 16:64403872-64403894 TTCTTTTAAAAGCATGTGGCTGG - Intergenic
1143577101 17:7800408-7800430 TCCATGTTGTAGCATGTGTCAGG + Intronic
1144211008 17:13015735-13015757 TTGCTTTTGAAAGATGTGTCAGG + Intronic
1144668416 17:17117515-17117537 CTCATGTTGGAGCATGTGTCAGG + Intronic
1148474782 17:47921008-47921030 TCCATGTTGTAGCATGTGTCTGG + Intronic
1149223998 17:54447454-54447476 CTCTTTTTGAAGCATGTGTATGG + Intergenic
1149583982 17:57772756-57772778 TTGATTTTGGAGCATGAGTCAGG - Intergenic
1151450809 17:74197144-74197166 TTTAATTTGAAGCATCTGTCTGG + Intergenic
1152490979 17:80633475-80633497 TTTGTTTTGTAGAATGTCTCCGG + Intronic
1152886723 17:82855912-82855934 TCTGTATTGTAGCATGTGTCAGG + Intronic
1153744588 18:8164533-8164555 TCCATGTTGTAGCATGTGTCAGG - Intronic
1154146533 18:11871036-11871058 CTCGTTTTTAAGTATGTGTGAGG + Intronic
1163150798 19:15412489-15412511 GTAGTTTTAAAGCAAGTGTCAGG - Intronic
1168484583 19:56750024-56750046 TCCGTGTTGTAGCATCTGTCTGG + Intergenic
925939916 2:8807234-8807256 TGCCTTTTGAATCATGTTTCAGG - Intronic
928937643 2:36696200-36696222 TTTTTTTTGAAACATGAGTCAGG + Intergenic
929661718 2:43792805-43792827 TTCCGTTTGTAGTATGTGTCAGG + Intronic
935672974 2:105571390-105571412 TCCATATTGTAGCATGTGTCAGG + Intergenic
936973545 2:118197358-118197380 TTCTTTTTCAGGCATTTGTCTGG - Intergenic
941774997 2:169383740-169383762 TTCATGTTGTAGCATATGTCAGG - Intergenic
941922831 2:170869286-170869308 TACATTTTGATGCATGTATCTGG - Intergenic
942039278 2:172041629-172041651 TTGGTTTTGAATTATGTATCTGG - Intronic
942266550 2:174233037-174233059 TTCATGTTGTAGCATGTGACAGG - Intronic
944340163 2:198586667-198586689 TCCATTTTGTAGCATGTTTCAGG - Intergenic
945138588 2:206658540-206658562 TTTGTTTTTAAGCATCTCTCAGG + Intronic
945574010 2:211507346-211507368 TTTGTTTTGTAGAATGAGTCAGG - Intronic
946924253 2:224610985-224611007 TCTGTGTTGCAGCATGTGTCAGG - Intergenic
1172296646 20:33816179-33816201 TTCATTCTTAAGCATGTGGCAGG + Intronic
1172611707 20:36257257-36257279 TCCGTGTTGTAGCATGTATCAGG - Intronic
1174957966 20:55122354-55122376 TTCGTTTTTAAAATTGTGTCTGG - Intergenic
1178440869 21:32597274-32597296 TCCCTGTTGGAGCATGTGTCAGG + Intronic
1179141088 21:38726091-38726113 TTTATTTTGCATCATGTGTCTGG - Intergenic
1179494919 21:41765597-41765619 ATCGTTGTGATGCCTGTGTCTGG - Intronic
1179912697 21:44458834-44458856 TTCATTTTTAAGCATCTGTTTGG - Exonic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1183763171 22:39843993-39844015 TGTGTTTTGAAGCATTTCTCAGG - Intronic
1184480104 22:44741556-44741578 TTCATGTTGTAGCATGTATCAGG - Intronic
949586438 3:5443442-5443464 TTCTTTTTGATGAAGGTGTCAGG - Intergenic
950162519 3:10771143-10771165 TTTGTCTTGAAGGCTGTGTCAGG - Intergenic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
952441879 3:33338862-33338884 TTCGTCATGAAGCATTTGCCAGG - Intronic
953028937 3:39163666-39163688 TGCGTTTTCAAACATGTTTCAGG - Intergenic
955630792 3:60972313-60972335 TCCTTTTTGAAGGATGTGTTCGG + Intronic
955680291 3:61493082-61493104 CTCATTTTGTAGCATGCGTCAGG + Intergenic
955944326 3:64177719-64177741 TTTCTGTTGTAGCATGTGTCAGG + Intronic
956456746 3:69429000-69429022 TCCATGTTGTAGCATGTGTCAGG + Intronic
956495382 3:69820157-69820179 TTCGTTTTGAATTATGTTTTGGG + Intronic
959008584 3:101048426-101048448 TTCATATTGTAGCAAGTGTCAGG - Intergenic
964435285 3:156644696-156644718 TTTGTTTTCAACCATGTTTCAGG - Intergenic
965136715 3:164782608-164782630 TTCATTTTGACACATATGTCTGG + Intergenic
965996999 3:174895707-174895729 TTTGTTTTGATGTATTTGTCTGG - Intronic
966438063 3:179911082-179911104 GTGGTTTTGAAGCCAGTGTCTGG + Intronic
973797094 4:54438611-54438633 TCTGTGTTGTAGCATGTGTCAGG + Intergenic
975692400 4:76978856-76978878 TTCATACTGAAGCATGTGGCTGG + Intronic
977274353 4:94957359-94957381 TTCCTTTTGCAACATGTGTGTGG + Intronic
977805877 4:101297338-101297360 TTAGTTTTGCCCCATGTGTCAGG - Intronic
978170415 4:105663611-105663633 TTCGTGTTGTAGCATGTGATAGG + Intronic
980462887 4:133139746-133139768 TTAATTTTGAAGCATGTTGCAGG - Intergenic
982146974 4:152405371-152405393 TTCGATTTGAAGGATATGGCTGG + Intronic
982580057 4:157165153-157165175 ATCATTTTGAAGCCTGTCTCAGG - Intronic
983811419 4:172066897-172066919 TTCTCTGTGAAGCATGAGTCAGG - Intronic
984480429 4:180294107-180294129 ATCTATTTGAAGCATGTGACTGG + Intergenic
987943205 5:24569131-24569153 TTCACTTTGTAGCATGTCTCAGG - Intronic
988519698 5:31934501-31934523 TTTGTTTTCAAGAATGTGTTAGG + Intronic
990511573 5:56493868-56493890 TTGGTTTAAAAGCATGTTTCTGG + Intergenic
991351552 5:65724398-65724420 TTCGTTTTGAAGCATGTGTCGGG + Intronic
994047897 5:95329916-95329938 TTCCTATTGAAACATTTGTCTGG + Intergenic
994475175 5:100259018-100259040 TTCGTGTTGTATTATGTGTCAGG + Intergenic
994663438 5:102680466-102680488 TTCGTCTTAAAGCATTTCTCTGG + Intergenic
994828960 5:104752789-104752811 TTAGTTTTCTAGCATATGTCTGG - Intergenic
994863534 5:105232194-105232216 TACTTTTTGAAGTATGGGTCTGG - Intergenic
995549089 5:113262988-113263010 TTAATTTTGAAAAATGTGTCAGG - Intronic
995923119 5:117337644-117337666 TTGGTTTAGAAGAATGTGTTTGG + Intergenic
997912852 5:137893531-137893553 TGCATTTTGAAGCATGAATCAGG + Intronic
999275403 5:150326619-150326641 TTCCCTTTGAAGCATTTCTCAGG + Intronic
1001252840 5:170161473-170161495 TTCATTTTCAAGAATATGTCTGG - Intergenic
1006710158 6:36061683-36061705 TTCCTTTTGATGAAAGTGTCTGG + Intronic
1008844539 6:55947317-55947339 TTAGTTTTAAAGCTAGTGTCTGG + Intergenic
1010722167 6:79295773-79295795 TTGGTTTTGTAGAATGTGTTAGG + Intergenic
1012324115 6:97893157-97893179 TTCTTTTGGTAACATGTGTCAGG - Intergenic
1013458424 6:110353572-110353594 ATCTTTTGGAACCATGTGTCAGG - Intronic
1014900696 6:126960554-126960576 TTTGTTTTGAAATATGTGTTTGG - Intergenic
1015753125 6:136581269-136581291 TTCATGTTGTAGCATGTGTCAGG + Intronic
1017477292 6:154810717-154810739 TTGGTTTTGGAGCAGGTGTGGGG + Intronic
1019782242 7:2948589-2948611 TTCCTGTTGTAGCATGTATCAGG + Intronic
1021085732 7:16420051-16420073 TGGCTTTTGAAGCATGTGTGAGG + Intronic
1025160068 7:56650457-56650479 TTCTTTTTGAAGCAGGATTCTGG + Intergenic
1026073141 7:67140899-67140921 TTGGTTTTGACCCAAGTGTCTGG + Intronic
1026703747 7:72671316-72671338 TTGGTTTTGACCCAAGTGTCTGG - Intronic
1032823623 7:135548166-135548188 ATCATCTTGTAGCATGTGTCAGG - Intergenic
1034333244 7:150301710-150301732 TCCATGTTGAAGCATGTGCCAGG - Intronic
1034664797 7:152808178-152808200 TCCATGTTGAAGCATGTGCCAGG + Intronic
1034941521 7:155233742-155233764 GTCCTTTTGAAGCTTGTCTCTGG - Intergenic
1036203501 8:6788427-6788449 TGTGTTTTGCAGCAGGTGTCTGG + Intergenic
1036640167 8:10578354-10578376 TTTGTTTTGTAGTATCTGTCTGG - Intergenic
1038135971 8:24786160-24786182 TTCATATTGTAGTATGTGTCAGG - Intergenic
1038333225 8:26626140-26626162 TCCATGTTGTAGCATGTGTCAGG + Intronic
1040848345 8:51870739-51870761 TTAGTTTTGAATTATGCGTCAGG - Intronic
1043198879 8:77337886-77337908 TTCATTCTGAAGTATGTGTCTGG + Intergenic
1043373439 8:79620455-79620477 TTTGTTCTGAAGCCTGTGCCAGG + Intronic
1043698820 8:83257450-83257472 TTTGTTTTGAAACATTTTTCTGG - Intergenic
1049977394 9:872629-872651 TCCGTGTTGTAGCATGTTTCAGG + Intronic
1051163906 9:14240374-14240396 TCCATTTTGAAGCATATGGCTGG + Intronic
1052250865 9:26395535-26395557 TTCATTTTTAAATATGTGTCAGG - Intergenic
1052959427 9:34282217-34282239 TTCATGTTGCAGCATGTATCAGG - Intronic
1053444194 9:38139036-38139058 TCCGTGTTGAAGCAGGTGTCAGG + Intergenic
1055539345 9:77286197-77286219 TTGGTCTTGAAGTCTGTGTCTGG + Intronic
1057002718 9:91527540-91527562 TCTGTGTTGTAGCATGTGTCAGG - Intergenic
1057743858 9:97735955-97735977 TTCCTTTTGAATCATGAATCAGG - Intergenic
1058619217 9:106864702-106864724 TTCATTTTTAAGCACGCGTCTGG + Intronic
1058744847 9:107980435-107980457 TTCGTTTTGAAACAAGTATTTGG - Intergenic
1059318825 9:113450377-113450399 TGCTTTTTAAAGCATGTGCCAGG + Intronic
1059838743 9:118188382-118188404 GTCATTTAGAAGCATATGTCTGG + Intergenic
1061201605 9:129141423-129141445 TTCCTTCTGCAGCATGGGTCTGG + Intronic
1061224166 9:129271025-129271047 TTCCTTTTGAAGATGGTGTCTGG + Intergenic
1187176999 X:16904924-16904946 TTTGTTTAAAAGCATGTGGCTGG + Intergenic
1188071463 X:25723422-25723444 TTCATTTTATAGCATGTGACAGG + Intergenic
1189654876 X:43234415-43234437 TTCATTTAGAATCAAGTGTCAGG + Intergenic
1195864932 X:109421422-109421444 TTCATGTTGTAGCATGTGACAGG - Intronic
1196238033 X:113305878-113305900 TTAGTTTTGAAGCAAGAGTTTGG + Intergenic
1197041447 X:121940554-121940576 TTCATTTTGAATTATGTGTGTGG + Intergenic