ID: 991353640

View in Genome Browser
Species Human (GRCh38)
Location 5:65746026-65746048
Sequence CCAACAGGCAGTTGGTCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991353636_991353640 -9 Left 991353636 5:65746012-65746034 CCAAGTGGAGCTACCCAACAGGC 0: 1
1: 0
2: 1
3: 18
4: 115
Right 991353640 5:65746026-65746048 CCAACAGGCAGTTGGTCATATGG 0: 1
1: 0
2: 2
3: 14
4: 130
991353634_991353640 1 Left 991353634 5:65746002-65746024 CCATTGACATCCAAGTGGAGCTA 0: 1
1: 0
2: 0
3: 11
4: 117
Right 991353640 5:65746026-65746048 CCAACAGGCAGTTGGTCATATGG 0: 1
1: 0
2: 2
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991353640 Original CRISPR CCAACAGGCAGTTGGTCATA TGG Intronic
900353249 1:2247363-2247385 CAAACAGGCCCTTGGTCATTTGG - Intronic
907892241 1:58647251-58647273 CCAGCGGGCATTTGGTCATTGGG + Intergenic
916459307 1:165006685-165006707 CCAGCAGGCAGTGGGGCAGAGGG + Intergenic
917618865 1:176774326-176774348 TCCATAGGCAGTTGGTCTTATGG - Intronic
921073698 1:211683309-211683331 CCAACACGCAGTTGGATACAAGG + Intergenic
923522631 1:234747353-234747375 CCAACAGGGAGTTGGGGATGGGG + Intergenic
1067841784 10:49686878-49686900 CCAACAGGGAGTAGGTCACAAGG - Intronic
1073265081 10:102222672-102222694 CCAACAGGCAGTTGGAAATAGGG + Intergenic
1073424259 10:103446728-103446750 ACAGCAGGCTGGTGGTCATAGGG - Intergenic
1073886192 10:108042692-108042714 CAAACAGGCAGTTGATAAGAAGG - Intergenic
1078385158 11:10884276-10884298 CGAACAGGGAGTAGGTCACAAGG + Intergenic
1079329365 11:19521068-19521090 CCAACAGCCATTTGGCCATGAGG + Intronic
1079783337 11:24637882-24637904 CGAACAGGAAGTAGGTCACAGGG - Intronic
1083550093 11:63581654-63581676 CAAACAGGGAGTAGGTCACAAGG - Intronic
1088917388 11:114238044-114238066 CCAACAGGCTGGAAGTCATATGG - Intronic
1096720863 12:53520617-53520639 CAAGCAGTCAGTTGGTTATATGG - Intronic
1097313554 12:58148510-58148532 ACAAGAGGCAGATGGCCATATGG - Intergenic
1097364420 12:58695715-58695737 CAAACAGGGAGTAGGTCACAAGG - Intronic
1098227750 12:68342154-68342176 CCAACAGGCTGTCTGGCATACGG + Intergenic
1099236380 12:80086867-80086889 TCAACAGGTAGTTGGACATCAGG + Intergenic
1104883353 12:132087812-132087834 TCAACAGGCAGTATGTCAGACGG - Intronic
1107657572 13:42607186-42607208 CCCACATGCAGTTTCTCATAAGG - Exonic
1107836484 13:44416064-44416086 CCAGCAGGCAGTTGGTCATTGGG - Intergenic
1108916797 13:55623893-55623915 CGAACAGGGAGTAGGTCACAAGG + Intergenic
1112408425 13:99141251-99141273 CGAACAGGAAGTAGGTCACAAGG - Intergenic
1114752590 14:25221947-25221969 CTAACAGGCAGTTGGACACATGG + Intergenic
1116035014 14:39617081-39617103 CCAGCAGGAAGTTGATCACAAGG + Intergenic
1117000201 14:51364240-51364262 GGAACAGGCAGTAGTTCATAGGG + Intergenic
1117133883 14:52713938-52713960 CCAAAAGGCTGTTTGTTATATGG + Exonic
1126012630 15:44317686-44317708 TCAGTAGGCAGTTGGACATATGG - Intronic
1126088474 15:45030865-45030887 TCAACAGGCAGTTGGTTACTGGG - Intronic
1128997162 15:72305769-72305791 CCAGCAGGCAGCTGGTAACATGG - Intronic
1129387947 15:75206306-75206328 AGAACAGGCAGTTGGTCAGCAGG - Exonic
1130583981 15:85165166-85165188 CAAACAGGGAGTAGGTCACAAGG - Intergenic
1135216243 16:20573813-20573835 CGAACAGGGAGTAGGTCACAAGG + Intronic
1140060133 16:71561856-71561878 CAAACAGGGAGTAGGTCACAAGG + Intronic
1141277208 16:82599225-82599247 CCAGCAGGCAGTTTTGCATATGG - Intergenic
1143000011 17:3787589-3787611 CCAACAGGAATGTGTTCATATGG - Intronic
1143100928 17:4504315-4504337 GCAGCAGGCAGTTAGTCACAAGG - Intronic
1143561307 17:7696893-7696915 CCACCAGGCAGTTGGATATATGG + Intronic
1144365259 17:14537731-14537753 CCAACTGGCAATTGGTCTGAGGG + Intergenic
1156846933 18:41676956-41676978 CCAACAGGCAGGTGGATGTATGG - Intergenic
1157758611 18:50241712-50241734 CAAACAGGGAGTAGGTCATAAGG + Intronic
1159458769 18:68695422-68695444 CAAATAAGCAGTTGGACATAGGG - Intronic
1162005813 19:7778219-7778241 CCCATAGGCAGGTGGTCATCGGG + Intergenic
1164025552 19:21348517-21348539 CAAACAGGGAGTAGGTCATAAGG + Intergenic
1202665168 1_KI270708v1_random:111792-111814 CGAACAGGGAGTAGGTCACAAGG + Intergenic
925660642 2:6198800-6198822 TCAACAGGGAGTAGGTCACAAGG - Intergenic
929067850 2:37998114-37998136 CCCACAGGAAGTTGATTATATGG - Intronic
929172539 2:38946160-38946182 CCAGCAGGCGGGAGGTCATAGGG + Intronic
929653773 2:43708598-43708620 CAAACAGGCAGTAGGTGGTATGG - Intronic
930303169 2:49642962-49642984 GTAACAGGCAGTTTGTGATAAGG - Intergenic
935379716 2:102439289-102439311 CAAGCAGGCAGTTGCTGATAGGG + Intronic
935940297 2:108230614-108230636 CCAACAGCCAATTGGGCACATGG - Intergenic
937178093 2:119962643-119962665 CCCACAGGCAGTTCATCTTATGG + Exonic
937344409 2:121115655-121115677 CCAATAGGTAGTTGGGTATACGG + Intergenic
937591509 2:123618574-123618596 CAAACAGGGAGTAGGTCACAAGG + Intergenic
941081349 2:161064328-161064350 TCAATTGGCAGTTGATCATAAGG + Intergenic
946669005 2:222082336-222082358 CCAACAGGAACTTAGTCATAAGG + Intergenic
947304988 2:228735805-228735827 CCAACAGGAATTTGGGCAGAGGG - Intergenic
1170945634 20:20888777-20888799 GCAACAGGAAGTTGGTTTTATGG + Intergenic
1172649888 20:36495465-36495487 GCAACAGGCAGTTGGAGTTAAGG + Intronic
1178127609 21:29532426-29532448 CCAACAGGCAGTCTGTCCTTGGG + Intronic
1180331890 22:11488712-11488734 CGAACAGGGAGTAGGTCACAAGG + Intergenic
951842776 3:27051968-27051990 CGAACAGGGAGTAGGTCACAAGG - Intergenic
954218995 3:49141212-49141234 CAAACAGGGAGTAGGTCACAAGG - Intergenic
954437003 3:50501599-50501621 GCAACGTGCAGTTGGTCAGATGG - Intronic
956664676 3:71631318-71631340 CCAACAGGCAGTTGCAAATACGG - Intergenic
959729445 3:109584164-109584186 CAAACAGGGAGTAGGTCACAAGG - Intergenic
962391171 3:134973993-134974015 CCAGCAGGAAGTTGGTGATTTGG + Intronic
963106213 3:141649388-141649410 CTAACAGGCATATGGGCATACGG - Intergenic
967747532 3:193074577-193074599 CCAATAAGCAGTTAGTGATATGG - Intergenic
968350256 3:198047261-198047283 CCAGCAGGGACTTGGTCATTGGG - Intergenic
972362365 4:38338876-38338898 CGAACAGGGAGTAGGTCACAAGG + Intergenic
973021759 4:45211465-45211487 CCAAGAGGCAGTTGCACTTATGG - Intergenic
973121169 4:46522453-46522475 CCAACAGACAGTAGGTCTGATGG - Intergenic
973244015 4:47990597-47990619 CAAACAGGGAGTAGGTCACAAGG - Intronic
975669247 4:76763645-76763667 ACAAGAGCCAGTAGGTCATAAGG + Intronic
976413215 4:84741264-84741286 GCACCAGGCAATTGGTAATAGGG + Intronic
976796707 4:88941799-88941821 CCAACAGGTAGTTTGTGCTATGG + Intronic
980046632 4:127996458-127996480 CGAACAGGGAGTAGGTCACAAGG + Intronic
981424519 4:144587806-144587828 CGAACAGGGAGTAGGTCACAAGG + Intergenic
981875903 4:149545439-149545461 CCAACAGGTAGATGATCATCAGG + Intergenic
981893601 4:149769275-149769297 CCAGCAGGCAGTTGAATATATGG - Intergenic
989644292 5:43612913-43612935 CCAACAGTCAGTTGCTTATATGG - Exonic
991127025 5:63081103-63081125 ACAACAGGCAGTTGGCCACTGGG - Intergenic
991353640 5:65746026-65746048 CCAACAGGCAGTTGGTCATATGG + Intronic
993172454 5:84436200-84436222 CCAACAGGGAGTAGGTCACAAGG - Intergenic
994813036 5:104547310-104547332 CAAACAGGGAGTAGGTCACAAGG - Intergenic
995133644 5:108657732-108657754 CCAACAGGCAGTTATTTATTTGG - Intergenic
995154139 5:108890543-108890565 CACACAGGCAGAGGGTCATATGG - Intronic
995856172 5:116594596-116594618 CAAACAGGCAATTGAGCATATGG - Intergenic
995894447 5:116996046-116996068 ACAACAGGCAGTTGGTCCACAGG - Intergenic
998260349 5:140626166-140626188 CCAGTAGGCAGTTAGCCATAGGG - Intergenic
998856890 5:146402310-146402332 CCAAATGGCAGTTGCTCTTATGG + Intergenic
999457487 5:151729592-151729614 CGAACAGGGAGTAGGTCACAAGG + Intergenic
1000564985 5:162835621-162835643 CCAAAAGGCTGATAGTCATATGG - Intergenic
1001197184 5:169684329-169684351 CCAACAAGCAAACGGTCATAAGG + Exonic
1001216635 5:169862477-169862499 CCAACTGACAGTTGATCGTATGG + Intronic
1002272782 5:178083700-178083722 CCAACAGGCAGTTCTTCCTGTGG - Intergenic
1002284266 5:178151831-178151853 CAAACAGGCAGATGGCTATAGGG - Intronic
1003000135 6:2324482-2324504 CCAAAATGCTGTTGGTGATATGG + Intergenic
1006339327 6:33438007-33438029 CCAACAGGCAGTGGGGGATCTGG + Exonic
1006576404 6:35049588-35049610 CCAACTGGCAGGGGGTCCTAGGG + Intronic
1006621941 6:35371453-35371475 CCAGCAGGCAGGTGGACACAGGG - Intronic
1008257396 6:49320675-49320697 CCTACAGGCAGGTGGTAATCAGG - Intergenic
1011057545 6:83221636-83221658 CCAACAGGCAACTGGAGATATGG + Intronic
1011736337 6:90314095-90314117 GCAGCAGGCAGTTGGAAATATGG + Intergenic
1012420029 6:99054763-99054785 CCAGAAGGCACTAGGTCATAAGG + Intergenic
1015104847 6:129523713-129523735 GCCACAGGCAGTTGAACATAAGG + Intergenic
1016500948 6:144720025-144720047 TAAACTAGCAGTTGGTCATATGG - Intronic
1019003556 6:168777482-168777504 GCTCCAGGCAGTTGGTCATTCGG + Intergenic
1021620159 7:22543228-22543250 GCACCAGGCAGCTGCTCATAAGG + Intronic
1028576909 7:92362412-92362434 CCAAAAGGAAGTTAGTCAAAGGG - Intronic
1029960427 7:104684595-104684617 CAAACAGGCAGTGGGCCATAGGG + Intronic
1030204109 7:106936092-106936114 CTAACAGGAGGTTGGTCTTAGGG - Intergenic
1031763012 7:125737731-125737753 CGAACAGGGAGTAGGTCACAAGG + Intergenic
1032575710 7:133051991-133052013 AAAACAGCCAGTTGGTTATAAGG + Intronic
1034517515 7:151592159-151592181 CCATCAGTCAGTGGCTCATAAGG - Intronic
1039331020 8:36536617-36536639 CGAACAGGGAGTAGGTCACAAGG + Intergenic
1041264437 8:56050687-56050709 CCAAAAGGCTGTTTGTTATATGG - Intergenic
1041287512 8:56275603-56275625 CAAACAGGGAGTAGGTCACAAGG - Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1044039070 8:87342745-87342767 CGAACAGGGAGTAGGTCACAAGG + Intronic
1044070249 8:87751465-87751487 CGAACAGGGAGTAGGTCACAAGG + Intergenic
1045593506 8:103626840-103626862 CAAACAGGAAGTAGGTCACAAGG + Intronic
1045981016 8:108187352-108187374 CCAGAAGGCAGGTGGTCAGAAGG - Intergenic
1048462259 8:134631006-134631028 CCACAAGGCAGCTGGGCATAAGG + Intronic
1048670362 8:136712480-136712502 CAAACAGGGAGTAGGTCACAAGG - Intergenic
1052223632 9:26057540-26057562 CCAAGAGGCAGCATGTCATAGGG - Intergenic
1052581039 9:30354298-30354320 CCCACAGTCAGTTTGTCAGAGGG - Intergenic
1054993029 9:71352555-71352577 CTAACAGGCACTTGGTCACATGG + Intronic
1056375737 9:86009263-86009285 GGAACAGGCAGTTGGTGAAATGG - Intronic
1061014587 9:127974413-127974435 CCAACAGGCACTTGTTCCCAGGG - Intronic
1203486866 Un_GL000224v1:64200-64222 TGAACAGGGAGTAGGTCATAAGG + Intergenic
1203499486 Un_KI270741v1:6100-6122 TGAACAGGGAGTAGGTCATAAGG + Intergenic
1185692572 X:2168361-2168383 CCAACAGACTGTTGGTCACACGG + Intergenic
1190462567 X:50693046-50693068 CTAATAGGAAGTTGGTTATATGG + Intronic
1193262447 X:79424740-79424762 CGAACAGGGAGTAGGTCATAAGG - Intergenic
1193629929 X:83872151-83872173 CCAACAAGCAAATGGTAATATGG - Intronic
1195579369 X:106483933-106483955 CAAACAGGCAGTTGTTTATCCGG - Intergenic
1197557012 X:127968208-127968230 CAAACAGGGAGTAGGTCACAAGG + Intergenic
1197903357 X:131396737-131396759 CCAACTGGTAGTTGGATATAAGG + Intronic
1199161184 X:144614070-144614092 GCAACAGGAACTTGGTCACAGGG + Intergenic
1199435764 X:147810940-147810962 CCAGCAGACAGTTGGGCAAATGG - Intergenic
1199539247 X:148940543-148940565 CAAACAGGCAGGTGGTAATAAGG - Intronic
1200076658 X:153554605-153554627 GCAACAGGCAGTAGGACACAAGG + Intronic