ID: 991354121

View in Genome Browser
Species Human (GRCh38)
Location 5:65749851-65749873
Sequence TTCCATAGGGAGCAGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991354121 Original CRISPR TTCCATAGGGAGCAGGGCCA AGG (reversed) Intronic
900682255 1:3923582-3923604 TTGATTAGGGAGCCGGGCCACGG - Intergenic
901454512 1:9355409-9355431 TTCCACAGGGCGGAAGGCCATGG - Intronic
901686863 1:10948020-10948042 TTCCATAGGAAGAACTGCCAGGG + Exonic
902273919 1:15325841-15325863 TTGGACAGGGAGCAGGGCCTTGG - Intronic
902921458 1:19668127-19668149 TTCTACAGGGAGCAGGGATAGGG - Intronic
903008831 1:20316276-20316298 GTCCAAAGGGAGCACGGACAGGG + Intronic
903619981 1:24691029-24691051 TTCCACAGGCAGCAGGAGCATGG - Intergenic
903878720 1:26493996-26494018 TTGCCTAGGGAGCAAAGCCATGG - Intergenic
906657540 1:47559480-47559502 CTCCCTAGTGTGCAGGGCCAGGG + Intergenic
908000516 1:59673994-59674016 TTGGTTAGGGAGCAGAGCCAGGG - Intronic
912424183 1:109571961-109571983 TTAGATAGGGAAAAGGGCCAAGG + Intronic
915243844 1:154542633-154542655 TTCCTTGGAGGGCAGGGCCAAGG + Intronic
917599830 1:176562911-176562933 TCCCATAGGGATGAGGGGCATGG - Intronic
920842847 1:209569209-209569231 TTCCAGATGGAATAGGGCCAAGG - Intergenic
921120232 1:212130028-212130050 TTCCAGAGTGAGCAGAGCCTTGG - Intergenic
921464111 1:215464722-215464744 TTACATAGAGAGCAGAGCCCTGG - Intergenic
922620496 1:226985379-226985401 TTACACAGGGAGCCGGGCCCTGG - Intronic
924624324 1:245687069-245687091 ATCCACAGTGAGCAAGGCCATGG + Exonic
1063339745 10:5252237-5252259 TCCCAGAGGATGCAGGGCCAGGG + Intergenic
1064154738 10:12894565-12894587 TGCAATAGGAAGCAGGGCCAAGG - Intergenic
1064290466 10:14029308-14029330 TTCCCTAGGGAGAAGGACTAAGG - Intronic
1065397967 10:25261765-25261787 CTCCAAAGGGAAAAGGGCCATGG - Intronic
1067697598 10:48547261-48547283 TCCCATGGGAATCAGGGCCATGG - Intronic
1069743992 10:70703366-70703388 TCCCATAGGGAGCTGGCACAAGG - Intronic
1070370412 10:75777081-75777103 TTTGTAAGGGAGCAGGGCCAAGG + Intronic
1070736162 10:78865228-78865250 CCCCAAAGGGAGCAGGGGCAGGG - Intergenic
1071845473 10:89517262-89517284 TTCCATGGGGGGCAGGGCGACGG + Intronic
1072409520 10:95187126-95187148 CTCCATAGGTATCTGGGCCATGG - Intergenic
1072783332 10:98264760-98264782 TTCCATCGGCAGCAGAGCCTTGG - Intronic
1072983321 10:100117823-100117845 TTCCATCAGGAGCAGAGCAATGG - Intergenic
1073180301 10:101579320-101579342 TTCCTCAGCGAGCAGGGCCCAGG - Exonic
1074610296 10:115015197-115015219 TTTCAGAGGGAGCATGGCCCTGG - Intergenic
1076336519 10:129710232-129710254 TTCCAAGAGGGGCAGGGCCACGG - Intronic
1076531885 10:131150402-131150424 TTCCACAAGCAACAGGGCCACGG + Intronic
1077216815 11:1398464-1398486 ATCCCCAGGGGGCAGGGCCAAGG - Intronic
1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG + Intronic
1077252597 11:1567216-1567238 TTGCACAGGGCGCAGGGCCCAGG - Intronic
1077408921 11:2394596-2394618 TTCCGTGGGGAGCAGGAACAAGG + Intronic
1078469474 11:11575513-11575535 TTTCAAAGGGAGGAGGGCCTGGG - Intronic
1080992575 11:37556807-37556829 TTCCATAGAGAGCAGGAACTGGG - Intergenic
1082784916 11:57311484-57311506 CTCCGGAGGGAGCAGGGCCAGGG - Intronic
1085015275 11:73169890-73169912 TTCCGAAGGTAGCAGGCCCATGG + Intergenic
1085119319 11:73957164-73957186 TTCCACATGGAGCCGGCCCAGGG + Intronic
1085510203 11:77084280-77084302 TTCTGTAGAGAGCAGGCCCATGG - Intronic
1089412816 11:118261042-118261064 TTTTATGGGAAGCAGGGCCATGG + Intronic
1091969789 12:4776849-4776871 TTCCAAAGGGAGCAGGGCCTTGG + Intronic
1093842434 12:23920647-23920669 TTGCATAAGGAGTAGGTCCATGG - Intronic
1094534936 12:31312966-31312988 ATCCATGGGGAAGAGGGCCAGGG - Intronic
1095953937 12:47796018-47796040 TGCCATAGGGAGCAGGGCGAGGG + Intronic
1096220446 12:49825720-49825742 CTTCATAGGCAGCAGGGCCCAGG + Intronic
1097241697 12:57580181-57580203 TTGCAAAAGGAGCAGGGCCTTGG - Intronic
1097287688 12:57890150-57890172 TTCCCAAGGGACCAGAGCCAGGG + Intergenic
1098071057 12:66675230-66675252 TTCCACAGGGAGCACGGCTCTGG - Intronic
1098430346 12:70412392-70412414 ATCCAGAGGTAGCATGGCCAGGG - Intronic
1101873462 12:108583368-108583390 TTTCATAGGGGGCAGGGCAGTGG - Intergenic
1101992830 12:109501315-109501337 TTCCATCTGATGCAGGGCCAGGG - Intronic
1104493664 12:129216578-129216600 CTCCAGAGGGAGCATGGCCCTGG + Intronic
1104775874 12:131389831-131389853 TTCCATGGGAAGCAGAGCCAGGG - Intergenic
1105291188 13:19054809-19054831 TTGCGGAGGGAACAGGGCCAGGG + Intergenic
1109332201 13:60943657-60943679 TTCTATAGGAAGCATGGCCCTGG - Intergenic
1109627186 13:64991480-64991502 TCCCATATGTAGCAGAGCCAAGG + Intergenic
1111835092 13:93378395-93378417 TTCCAGATGGAGCAGAGCAAAGG - Intronic
1112423705 13:99276959-99276981 TCCCAAAGGTTGCAGGGCCAGGG - Intronic
1114577542 14:23727903-23727925 TTGCTTAGGGTGCAGAGCCAGGG - Intergenic
1114620777 14:24094815-24094837 TTCGAGAGGCAGCAGGGCCCTGG + Intronic
1114699527 14:24663190-24663212 TTCCATGGGCAGGATGGCCACGG + Intergenic
1117460566 14:55940780-55940802 TTTCAAAGGGAGCACAGCCATGG - Intergenic
1118322063 14:64759163-64759185 GTGGATAGGAAGCAGGGCCATGG - Intronic
1120929753 14:89836532-89836554 CACCATGGGGAGCAGGGCTAGGG + Intronic
1121017981 14:90559981-90560003 TTCCAGAGGGACAGGGGCCAAGG - Intronic
1122124651 14:99572422-99572444 TTCCCTGTGGAGCAGGGCCTTGG - Intronic
1123977227 15:25564842-25564864 TTCCTTAAGGAGCAGCGGCATGG + Intergenic
1124892743 15:33748040-33748062 TTCCATGCGGAGATGGGCCAGGG + Intronic
1125824688 15:42666399-42666421 TTACATAGGGAGAAGGGGTAAGG + Intronic
1127640781 15:60913915-60913937 TTCCATAGGAAGCAGTGACATGG - Intronic
1128521708 15:68379622-68379644 TTCCTGAGAGAGCTGGGCCAAGG - Intronic
1128749376 15:70138086-70138108 CTCCTTAGGCAGCTGGGCCATGG - Intergenic
1129190354 15:73933893-73933915 TTCCACAGGCAGCTGGACCAAGG + Intronic
1129677160 15:77637910-77637932 TCCCCTAGAGAGGAGGGCCAGGG + Intronic
1129920585 15:79316202-79316224 TTCCATAGTGACCAGGGCCCAGG + Intronic
1130895967 15:88170757-88170779 TTCCAGAGTGATGAGGGCCAGGG - Intronic
1131225711 15:90623132-90623154 ATCCAGCGGGAGGAGGGCCAGGG - Intronic
1133058659 16:3160223-3160245 TCCCATAGGGAGCAGGGGCACGG - Intergenic
1133334445 16:4997733-4997755 TTTCAGAGGGAGCACGGCCCTGG - Intronic
1135090358 16:19509463-19509485 TTCCCTAGGGAGAATGGCCCAGG + Intronic
1136112854 16:28075702-28075724 TTCCACGGTGAGCAGGGCCTGGG + Intergenic
1136616023 16:31399073-31399095 TTCCACAGAGAACAGGGCCTGGG + Intronic
1136682972 16:31978674-31978696 TTCCATGGGAAGGATGGCCAGGG + Intergenic
1136783613 16:32922230-32922252 TTCCATGGGAAGGACGGCCAGGG + Intergenic
1136886178 16:33931576-33931598 TTCCATGGGAAGGACGGCCAGGG - Intergenic
1137963763 16:52911132-52911154 TTCCACCTGGAGCAGGGGCAAGG + Intergenic
1138417780 16:56881107-56881129 CTGCATAGGGAGCAGGGGCCAGG - Intronic
1139407059 16:66727514-66727536 TTCCAGAGGAAGAAGGTCCATGG - Intronic
1141317616 16:82977170-82977192 TCCCAGAGAGAGCAGGGCCAAGG - Intronic
1142278418 16:89135225-89135247 TTCCACAGGGAGCAGAGCGGGGG + Intronic
1203086259 16_KI270728v1_random:1186224-1186246 TTCCATGGGAAGGACGGCCAGGG + Intergenic
1143591683 17:7888901-7888923 TCCCAAAGGGAGCAGGGAGATGG + Intronic
1143731643 17:8885590-8885612 TTACCTAGGAGGCAGGGCCATGG - Intronic
1143731682 17:8885672-8885694 TTACCTAGGAGGCAGGGCCATGG - Intronic
1143731796 17:8885935-8885957 TTACCTAGGAGGCAGGGCCATGG - Intronic
1144967797 17:19089024-19089046 TGCCATAGGGAGCCCGGCCCGGG + Intergenic
1144980119 17:19163039-19163061 TGCCATAGGGAGCCCGGCCCGGG - Intergenic
1144988103 17:19215193-19215215 TGCCATAGGGAGCCCGGCCCGGG + Intergenic
1145777096 17:27536777-27536799 TTCCATCAGGGGCAGGCCCAGGG + Intronic
1145916122 17:28575093-28575115 TTCCATTCAGAGCAGGGCCAGGG + Intronic
1147143877 17:38474383-38474405 TTCCAGGGGAAGGAGGGCCAGGG + Intronic
1147748248 17:42709391-42709413 GTCACTAGGGAACAGGGCCAGGG + Intronic
1147824430 17:43261393-43261415 TTCCACAGGGGGCCTGGCCACGG - Intergenic
1149869820 17:60171360-60171382 ATCCATAGGGAGCAGCCCCAGGG - Intergenic
1150134511 17:62688634-62688656 TGCCACTGGGAGCAGGGCTAGGG - Exonic
1150164073 17:62924722-62924744 TTTCAGAGGGAGCATGGCCCTGG + Intergenic
1151234192 17:72706768-72706790 TTCCATAGGGAGCACTCCCTGGG - Intronic
1151444350 17:74153477-74153499 TTCCCTAGGCAGCAAGGTCAGGG + Intergenic
1151526240 17:74670899-74670921 TTTCCTAGGGAGAAGGTCCAGGG - Intronic
1151538552 17:74752312-74752334 TGCCAGATGGAGAAGGGCCATGG - Intronic
1154144555 18:11856293-11856315 TTCCATAGGGAGCCCGGGCCAGG + Intronic
1155041654 18:22070020-22070042 CTCCCTAGAGGGCAGGGCCATGG - Intergenic
1155304390 18:24464815-24464837 TTCTACTGGGAGCAGGGGCATGG + Intronic
1155668711 18:28343535-28343557 TTCAATAGAGAGTAGGACCAAGG - Intergenic
1162335227 19:10056005-10056027 TTCCTGAGGGAGGAGGGCCAGGG - Intergenic
1166740682 19:45113086-45113108 TTCCATAGTGTGCAGGGCTGGGG + Intronic
1166994790 19:46714913-46714935 TTCCCAAGGGGTCAGGGCCAAGG - Intronic
1167124462 19:47539704-47539726 ACACATAGGGAGCATGGCCATGG - Exonic
1168187461 19:54709217-54709239 GCCCACAGGGAACAGGGCCAGGG - Intergenic
925844906 2:8026429-8026451 GTACATAGAGAGGAGGGCCATGG - Intergenic
926108399 2:10166689-10166711 CGCCATAGGGAACAGGGCGAGGG - Intronic
926843114 2:17105044-17105066 TTCCATGGGGGGTAGGGCCGTGG + Intergenic
929547952 2:42868283-42868305 TTCCCGAGGGACCACGGCCATGG + Intergenic
931780675 2:65576961-65576983 TGCCATAGTGAGAAGAGCCAGGG - Intergenic
933262417 2:80145510-80145532 TTCCATATGGAGTAGGCACATGG - Intronic
934533083 2:95108175-95108197 CTCCACAGGGACCAGGGTCAGGG + Exonic
936402598 2:112176751-112176773 TTCCATAGAAAGCAGTTCCAGGG - Intronic
937789754 2:125945699-125945721 TCCCCCAGGGTGCAGGGCCAGGG - Intergenic
938494430 2:131785882-131785904 TTCCACTTGGACCAGGGCCAGGG - Intergenic
945234333 2:207620752-207620774 TTCGACAGGGAGCATGGGCAGGG - Intronic
945923837 2:215783282-215783304 TCCCAGAGGTAGCATGGCCAAGG - Intergenic
946054298 2:216887454-216887476 GTCCACAGGGAGCAGGGCCAGGG - Intergenic
946410695 2:219513812-219513834 TCCCAGAGGGGGCAGGGGCATGG + Intergenic
946644986 2:221823728-221823750 TTCAAAATGGAGCAGGGGCAGGG + Intergenic
946809981 2:223513343-223513365 TTCCATAGGCACCAGGGTCCTGG - Intergenic
947810266 2:232999692-232999714 AGCCAGAGGGAGGAGGGCCAGGG + Intronic
1169321267 20:4635083-4635105 TTTCAGAGGGAGCAGGTGCAGGG - Intergenic
1170478700 20:16743765-16743787 TTCAATAGGGAGCAGGGGAAAGG + Intergenic
1171012255 20:21515100-21515122 GCCCAGAGGCAGCAGGGCCAGGG - Intergenic
1173185554 20:40837222-40837244 TTACATAGGGAGCAGGGGTGGGG - Intergenic
1173737000 20:45369136-45369158 TTCCAGAGAGGGCAGGGCAATGG + Exonic
1173945419 20:46946384-46946406 CTCCCCAGGGTGCAGGGCCAAGG + Intronic
1174384408 20:50178563-50178585 CTCCAGAGGGAGCAGGACCCTGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176711686 21:10155388-10155410 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1181939065 22:26461513-26461535 TTCCACAGGGAGTAGGGGTAGGG - Intronic
1182285019 22:29241192-29241214 CTCCAGAGGAACCAGGGCCAGGG - Intronic
1183491631 22:38119999-38120021 TTCCCTAGGGTCCAAGGCCAGGG - Intronic
1184783382 22:46660041-46660063 GAACACAGGGAGCAGGGCCACGG - Intronic
1203309040 22_KI270736v1_random:129697-129719 TTCAATGGGGAGCAGTGCAACGG + Intergenic
949317721 3:2775308-2775330 TTGCATGGGGAAGAGGGCCATGG - Intronic
950273524 3:11639250-11639272 GTCCCCAGGGAGCAGGGACAGGG - Intronic
951537405 3:23752245-23752267 CTCCCTAGGGGGCAGGACCAGGG + Intergenic
952284680 3:31956756-31956778 TACTCTAGGGAGCAAGGCCAGGG - Intronic
953167894 3:40481782-40481804 TTCCATGGGGCTCAGTGCCATGG + Intronic
953412774 3:42699559-42699581 TTCCCAAGTGAGCAGGGCCCGGG + Intronic
954626822 3:52026379-52026401 TTCCATGAGGAGCAGAGCAAGGG - Intergenic
955505952 3:59633338-59633360 TTCCATGGGAAGAAGGGACACGG - Intergenic
958923019 3:100127312-100127334 TTCCCTCGAGAGCAGGGCCCAGG + Intronic
960971356 3:123142226-123142248 TCCCATTGGGAGCAGGCTCAGGG + Intronic
962443311 3:135443176-135443198 TTGCAGAGAGAGCATGGCCATGG - Intergenic
967706065 3:192652296-192652318 TTCAATAGGGAGCATAGCAAGGG + Intronic
968038677 3:195570179-195570201 TCCCATAGGGATCAGGGACGGGG - Intronic
970469180 4:16358945-16358967 TCCCATAGGGATCATGGCAATGG - Intergenic
970824080 4:20252592-20252614 TTCCGGAGGGCGCAGAGCCACGG - Intergenic
973211191 4:47617511-47617533 TTCCATAGAGGGCAGGGCAGTGG + Intronic
976430270 4:84955422-84955444 GTCCGTAGGCAGCAGGCCCAGGG - Intronic
978210400 4:106129192-106129214 TTACATAGGAAAGAGGGCCATGG + Intronic
978287665 4:107098054-107098076 ATCCATAGAGAGGAGGGGCAGGG + Intronic
979068348 4:116167384-116167406 TTACATAGGGATTCGGGCCAAGG - Intergenic
981827173 4:148956589-148956611 TTCAATGAGCAGCAGGGCCAGGG - Intergenic
985086794 4:186322067-186322089 ATCCAGAGGCAGCAGGGCCGTGG - Intergenic
985778286 5:1856822-1856844 TTCCAGAGGGAGCATTTCCAAGG + Intergenic
988836391 5:35036819-35036841 GTCCCTAGGAAGCAGGGACATGG - Intronic
988853672 5:35204401-35204423 TTCCTAAGGGAGCAGGGCTTTGG + Intronic
991086656 5:62653850-62653872 TTCCATGGGGAAAAGGGTCATGG - Intergenic
991354121 5:65749851-65749873 TTCCATAGGGAGCAGGGCCAAGG - Intronic
992203800 5:74410046-74410068 ATCCATAGGCAGGAGGGCCTGGG + Intergenic
994183759 5:96796577-96796599 TTTCAGAGGGAATAGGGCCAAGG + Intronic
994269194 5:97756720-97756742 GTCCATAGGGATAAGGGTCAGGG - Intergenic
997248244 5:132369773-132369795 TTACATAGGGCGCACGACCAGGG - Exonic
997808028 5:136938986-136939008 TTCTTTGGGGAGCAGGGCAAAGG + Intergenic
998199904 5:140111439-140111461 TTCATTAGGGAGCAGGGGCTTGG + Intronic
998724266 5:144991460-144991482 TTTCATGGGGATCAGGGCAAAGG - Intergenic
999553133 5:152711909-152711931 TTGAATAGGGAGCAGGGGAATGG - Intergenic
1000800146 5:165715534-165715556 ATCTTCAGGGAGCAGGGCCATGG + Intergenic
1002428055 5:179187332-179187354 GAGCACAGGGAGCAGGGCCAGGG - Intronic
1003114213 6:3272694-3272716 TGCCACAGTGACCAGGGCCATGG - Exonic
1006604906 6:35249149-35249171 CACCCTAGGGAGCAGAGCCAGGG - Exonic
1007167843 6:39841200-39841222 TTCCATGGGGAGGAGCTCCAGGG + Intronic
1011258170 6:85445315-85445337 TCCCATAGGCAGCAGGACCTGGG - Intergenic
1014963119 6:127711791-127711813 TTTCTTAGGGAGCAGGGGGATGG + Intronic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1019033487 6:169033911-169033933 TTCCATAGGGATGAGGACTAAGG + Intergenic
1019038495 6:169083228-169083250 CTTCCTAGGGAGGAGGGCCAGGG - Intergenic
1021941499 7:25683248-25683270 TTCCTAAGGGGGCAGGGCAAGGG + Intergenic
1022470390 7:30678504-30678526 TTCCAGATGCAGCAGGGCCAAGG - Intronic
1023053603 7:36274067-36274089 TCCCAGAGGGGGCAGGCCCAAGG - Intronic
1023890851 7:44391009-44391031 TTCCATAGAGACAAGGGCCAGGG + Intronic
1024654281 7:51435913-51435935 TCCCAAAGGGAAAAGGGCCAGGG - Intergenic
1025007481 7:55365770-55365792 CTCCGTCGGGAGCAGGGCAAAGG + Exonic
1025744535 7:64231355-64231377 TTCCCTTGTGAGCAGGGCCCAGG + Intronic
1029014567 7:97302121-97302143 TTCCATGGGGAGGGGTGCCATGG + Intergenic
1031029086 7:116715285-116715307 CTCCAGAGGGAGCATGGCCCTGG - Intronic
1033947299 7:146736227-146736249 TTTCATATGGAGCAGGGTCCTGG + Intronic
1035534777 8:382576-382598 TTCCTCAGGGAGCACGGCCAGGG - Intergenic
1037258421 8:16980573-16980595 TTCTATATGGAGAAGAGCCATGG + Intergenic
1037316654 8:17605720-17605742 TTTCCTAGGGAGCAGGACCAGGG - Intronic
1037539313 8:19856196-19856218 TTCCAGAGGGCCCTGGGCCAGGG - Intergenic
1038262013 8:26003711-26003733 TTCCCCAGGGATCATGGCCAGGG - Intronic
1039518595 8:38152977-38152999 TCCCACAGGGAGCAGGGCCTGGG - Intergenic
1039755695 8:40519481-40519503 TGCAATTGGGAGCAGGGCAAGGG - Intergenic
1040415525 8:47191420-47191442 TTCTACATGTAGCAGGGCCATGG - Intergenic
1041224522 8:55685301-55685323 GTCCATGGGGAGCAGAGCAAAGG - Intergenic
1042147280 8:65743291-65743313 TTCAAAAAGGAGAAGGGCCAAGG + Intronic
1042961533 8:74308811-74308833 AGCCAGAGGGAGCAGGGACAGGG + Intronic
1047169944 8:122483093-122483115 TTCTGTAGGGAGCAGAGCCAGGG + Intergenic
1047340493 8:123976120-123976142 TTGGATAGAGAGCAGGGCCCTGG - Intronic
1048186447 8:132246101-132246123 TTCCACACGGGGCATGGCCAGGG + Intronic
1048209457 8:132442904-132442926 TTGCATAGGGAGAAGGGGCTGGG - Intronic
1049193233 8:141300543-141300565 TGCCATTAGGATCAGGGCCATGG - Intronic
1049565439 8:143335562-143335584 TTCACTGGGGAGCATGGCCAAGG + Intronic
1052348671 9:27435926-27435948 TCACAGAGGGAGCAGGGCCTTGG - Intronic
1053383857 9:37671510-37671532 TTCCACATTGAGCAGGGCCGTGG - Intronic
1053648677 9:40141079-40141101 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1053757069 9:41322763-41322785 TTCCACTTGGACCAGGGCCAGGG + Intergenic
1054329659 9:63739020-63739042 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1054535906 9:66235091-66235113 TTCCATTTGGACCAGGGCCAGGG + Intergenic
1055358440 9:75462304-75462326 TTCTCCAGGGAGCAGGGGCAGGG - Intergenic
1055866579 9:80821402-80821424 TTCCCTGGGGAGCAGGTCCATGG - Intergenic
1056503954 9:87239036-87239058 TTCCATTGTCAGCAGGGCTACGG - Intergenic
1057548859 9:96037639-96037661 TCCAAGTGGGAGCAGGGCCAGGG + Intergenic
1060737236 9:126073764-126073786 GACCAGAGGGAGAAGGGCCAGGG + Intergenic
1060801342 9:126547666-126547688 TGCCACAGGGACCAGGGACAGGG - Intergenic
1062252174 9:135603836-135603858 TTCTATAGGGATCAGCACCAGGG - Intergenic
1202796441 9_KI270719v1_random:124377-124399 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1188025050 X:25199627-25199649 TCCCATAGGGAGAAGGGACGTGG - Intergenic
1190366157 X:49696247-49696269 TGCCATAGGGACAAGGACCATGG + Intergenic
1190713679 X:53087175-53087197 TTCCATTGAGGGCAAGGCCAGGG + Intronic
1195936102 X:110127108-110127130 CTCCATATGGAGCAGGGACCAGG + Intronic
1198657526 X:138931281-138931303 TTCCCTAGGCAGCAGGGCTGTGG + Intronic
1199579024 X:149343082-149343104 TTGGATGGGGAGCAGGGTCATGG - Intergenic
1200058890 X:153475245-153475267 GCCCATAGGGAGCAGGGCCGTGG - Intronic
1200864707 Y:8030974-8030996 TACCATAGGGAGCTGGGCACAGG - Intergenic
1200907311 Y:8497237-8497259 TTCTATGGTGAGCAGGGCCCAGG - Intergenic
1202260153 Y:22961874-22961896 TTCTATGGTGAGCAGGGCCCAGG - Intergenic
1202413140 Y:24595615-24595637 TTCTATGGTGAGCAGGGCCCAGG - Intergenic
1202457642 Y:25074453-25074475 TTCTATGGTGAGCAGGGCCCAGG + Intergenic