ID: 991354984

View in Genome Browser
Species Human (GRCh38)
Location 5:65759514-65759536
Sequence TGGAAAGTCCAGAATCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991354984 Original CRISPR TGGAAAGTCCAGAATCTCAG TGG Intronic
902453426 1:16514105-16514127 TTGAAACTCCAGAAAGTCAGGGG + Intergenic
902473476 1:16666768-16666790 TTGAAACTCCAGAAAGTCAGGGG + Intergenic
902485327 1:16740674-16740696 TTGAAACTCCAGAAAGTCAGGGG - Intronic
902499058 1:16896138-16896160 TAGAAACTCCAGAAAGTCAGGGG - Intronic
902699352 1:18161099-18161121 AGCAAACTCCTGAATCTCAGGGG + Intronic
906071325 1:43018871-43018893 TGGTAGGTCCAGAATTCCAGTGG + Intergenic
907378699 1:54066904-54066926 TAGATGGTCCAGAATCTCATTGG - Intronic
907896374 1:58696592-58696614 TGGAAACTACAGGACCTCAGAGG - Intronic
908850978 1:68375379-68375401 TGGGAATTCGGGAATCTCAGTGG + Intergenic
909215056 1:72876279-72876301 TGGGAAGCCCAAAATCACAGTGG - Intergenic
909469081 1:76006384-76006406 TTGAAAGTACAGGATCCCAGGGG - Intergenic
910538614 1:88329149-88329171 TGGCAAGTCCAAAATCTGATGGG + Intergenic
910643171 1:89486534-89486556 TGTAAAATCCAGAAGCTAAGTGG + Intergenic
911744162 1:101420772-101420794 TGGCAAGTCCAAAATCTGATAGG - Intergenic
911812482 1:102300637-102300659 TGGGAAGTCCAGAGTCATAGGGG - Intergenic
912672501 1:111643887-111643909 TGGAAAGTCCAAAATCTATATGG + Intronic
913014376 1:114717806-114717828 TGAAAAGTGCAGAATTTCATAGG + Exonic
915167506 1:153956635-153956657 TGGCAACCCCAGTATCTCAGTGG + Intronic
915668969 1:157471097-157471119 AGGAAAGTCCACAATCTTTGTGG - Intergenic
915730361 1:158049465-158049487 TAGAAATCCCAGACTCTCAGAGG - Intronic
917071055 1:171151288-171151310 AGGAAATTCCGGAATCTCAAAGG + Intronic
918286882 1:183065342-183065364 TGGCAAGTCCAAAATCTGTGGGG + Intronic
918569518 1:185972318-185972340 TGGAAATTCCAGAAGCTAAAAGG - Intronic
920190135 1:204188467-204188489 TGCAAAGCCCAGAGTCTCAAAGG + Intergenic
920302902 1:205000288-205000310 TCTAAAGCCTAGAATCTCAGGGG - Intronic
920530995 1:206702450-206702472 AGGAAAGGTCTGAATCTCAGTGG + Intronic
922236366 1:223725681-223725703 GGGAAGGTCCGGAAACTCAGAGG + Intronic
922818321 1:228467120-228467142 TGGGAAGACCAGCATCTCACTGG - Intergenic
924711306 1:246532136-246532158 TGCAAAGTCCAGGATCCCCGAGG + Intergenic
924865966 1:247980658-247980680 TAGAATGTCCAAACTCTCAGTGG + Intronic
924868520 1:248013459-248013481 TAGAATGTCCAAAGTCTCAGTGG + Intronic
924869869 1:248029956-248029978 TAGAATGTCCAAAGTCTCAGTGG + Intronic
1063612816 10:7577081-7577103 AGGAAACTGCAGACTCTCAGGGG + Intronic
1064348612 10:14556361-14556383 TGAACAGTCCAGAAACTCTGAGG - Intronic
1065367495 10:24950752-24950774 TGGAAAGTCCCAAATATAAGAGG - Intronic
1065625801 10:27627151-27627173 TGGAAAGTACAGAAAGTGAGAGG + Intergenic
1067259637 10:44677480-44677502 TGAAAACTCCAAATTCTCAGTGG - Intergenic
1068858510 10:61822700-61822722 TGGAGAGTGCAGAATCTCTTAGG + Intergenic
1070822767 10:79372100-79372122 AGGAAAGCCAAGAATATCAGAGG - Intergenic
1072378763 10:94844248-94844270 AAGAAAGTGCAGAATTTCAGAGG + Intronic
1072403424 10:95127901-95127923 TGCAAAGTCCAGAATCCCTGAGG - Intergenic
1073971930 10:109053603-109053625 AGCAAAGTCCAGATTCTTAGGGG + Intergenic
1075296563 10:121281521-121281543 TGGCAAGTCCAAAATCTGTGGGG - Intergenic
1075604599 10:123795477-123795499 TGGAAAGTGCAGACTCGGAGAGG + Intronic
1076056875 10:127382930-127382952 TGGAAAATTCAGAAGCCCAGGGG - Intronic
1077719415 11:4612551-4612573 CAGAAAATCCAAAATCTCAGGGG - Intergenic
1077981860 11:7308952-7308974 AGGAAAGGCCAGAATCCCAGAGG - Intronic
1079010267 11:16822420-16822442 AGGAAAGTCCAGAACCTCACGGG - Intronic
1079709694 11:23666171-23666193 AGGAAAGTCCACCCTCTCAGAGG - Intergenic
1080726139 11:34901183-34901205 TGCAAAGTCCAGAATCCCCAAGG + Intronic
1081265062 11:41010739-41010761 AGGAAAGTCCTGATTCTCAGTGG - Intronic
1081650711 11:44822316-44822338 AGGTAAACCCAGAATCTCAGTGG + Intronic
1082708896 11:56528237-56528259 TAGAGAGTCCAGAATCATAGGGG + Intergenic
1083814453 11:65124723-65124745 TGGAGAGTCCAGAGCCTCATGGG - Intronic
1085735849 11:79038372-79038394 TTGAAATTCCAGAGTCCCAGAGG - Intronic
1087219028 11:95526176-95526198 TGGGAATTTCAGAATCTCTGTGG + Intergenic
1088500908 11:110481299-110481321 AGGACATACCAGAATCTCAGAGG + Intergenic
1089465467 11:118682429-118682451 TGGCAAGTCCAAAATCTCTAGGG + Intergenic
1089532140 11:119137107-119137129 TGGCAAGTCCACAACCACAGAGG + Intergenic
1091425917 12:389280-389302 GGAAAAGTCCTGAACCTCAGTGG - Exonic
1092337059 12:7642493-7642515 TGCAAAGTCCAGGATCCCGGAGG + Intergenic
1093273478 12:17095406-17095428 TGGAAAGTCTAAAATCTCATGGG + Intergenic
1093618321 12:21255561-21255583 TTGATACTACAGAATCTCAGTGG - Intergenic
1095942009 12:47733506-47733528 TGAAGAGTCCAGAATCTGAGAGG + Intergenic
1097400513 12:59123017-59123039 TGGAAATTCCAGGATCTAATTGG + Intergenic
1097599557 12:61673733-61673755 TGGAAAGTCCAAGATCACAGTGG - Intergenic
1098008566 12:66025170-66025192 TGGCAAGTGCAGAATTTTAGTGG + Intergenic
1099051369 12:77785259-77785281 GGCAGAGTCCAGAGTCTCAGAGG - Intergenic
1099105559 12:78491749-78491771 TTTAAATTCCAGATTCTCAGGGG + Intergenic
1100198437 12:92273279-92273301 TGGCAAGTCCACAATCTGATGGG - Intergenic
1100754934 12:97740891-97740913 TGGAAATTATAGAATCTCAGAGG + Intergenic
1101273178 12:103170027-103170049 TGGAAAGTCAAGAAGCTAAAAGG + Intergenic
1101786860 12:107891890-107891912 TGGAAAGTCCAGATGCTTTGGGG - Intergenic
1102152731 12:110699818-110699840 TAGAAAGTCCTAAATATCAGTGG + Intronic
1102720245 12:115009756-115009778 TGGAAAGCTCAGAGTCTCTGTGG + Intergenic
1103197748 12:119059864-119059886 TGAAATGTCCAGAATCTCTGGGG + Intronic
1105656596 13:22447589-22447611 TTGAAAGGCCAGCATGTCAGTGG - Intergenic
1105985141 13:25558596-25558618 AGGAAACTCCAGTTTCTCAGTGG - Intronic
1109215575 13:59585884-59585906 AGGAAATTCCTGATTCTCAGTGG + Intergenic
1109657597 13:65414189-65414211 TGGAAAGCCTAGAATTTAAGAGG - Intergenic
1111012102 13:82326595-82326617 TGAAAAGTCCAGTATCCCAGAGG + Intergenic
1111186850 13:84748717-84748739 TGGTAAGTCCAAAATCTGATCGG - Intergenic
1111230019 13:85332942-85332964 TGTAAAGGCCTGAATTTCAGTGG - Intergenic
1111783925 13:92763962-92763984 TGGTAATCCCAGACTCTCAGTGG + Intronic
1112727634 13:102322698-102322720 TGGAACTTCTAGAATTTCAGAGG + Intronic
1113008482 13:105735730-105735752 AGGAAAGTCCAGCTGCTCAGGGG + Intergenic
1113673227 13:112189220-112189242 TGAAAAGTCCCCAACCTCAGAGG + Intergenic
1114409582 14:22488147-22488169 TGGAAATGCCAGGCTCTCAGAGG - Intergenic
1115192003 14:30755877-30755899 AGGGAAGTCCAGACTCTGAGGGG + Intergenic
1115894775 14:38074167-38074189 TGGAAACTCCAAAATCGTAGGGG + Intergenic
1116037723 14:39648036-39648058 TGGAAATTTCAGAATTTCAATGG + Intergenic
1117297886 14:54395645-54395667 TGGAGAGTCCAAAATCTGATGGG - Intergenic
1118723435 14:68609839-68609861 TGGGAAGCCCAGAAACTCTGAGG - Intronic
1119987250 14:79151661-79151683 TGGAAATCTCAGATTCTCAGAGG - Intronic
1121224836 14:92313842-92313864 TGGGAAGTCCAGATCCACAGAGG + Intergenic
1121688225 14:95855596-95855618 TGAAAAGTTCAGCAGCTCAGGGG + Intergenic
1122725483 14:103748006-103748028 TGGCAAGTCCAGAATCTGTGAGG - Intronic
1123771543 15:23534729-23534751 TCAAAAGTCCAAAATCTCATCGG - Intergenic
1124479307 15:30063993-30064015 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1124915172 15:33963378-33963400 TGGAAGGTCTAAAATCTCTGTGG + Intronic
1124964056 15:34420270-34420292 TGTAAAATCAACAATCTCAGTGG + Intronic
1124980670 15:34566501-34566523 TGTAAAATCAACAATCTCAGTGG + Intronic
1128068543 15:64779187-64779209 TAGAAATTCGAGAAGCTCAGAGG - Intergenic
1133738042 16:8630517-8630539 TGGAAAGTCCTGCTTCTCAGGGG + Intronic
1137380668 16:47996253-47996275 TGGAAAGATCATAACCTCAGGGG + Intergenic
1138389215 16:56658030-56658052 TGGAAAGTCCAGTCTCTCCTCGG + Exonic
1138406513 16:56799095-56799117 TGGAAAGACCAGAAAATTAGTGG + Intronic
1138452367 16:57101182-57101204 TGGAAAGTCCAAAATCTGTAGGG - Intronic
1138522767 16:57580796-57580818 TTGAAACTACAGAATGTCAGAGG + Intronic
1138734997 16:59240208-59240230 AGGAAACTCTAGAATATCAGAGG - Intergenic
1139528697 16:67531100-67531122 TTCCAAGTCCAGAATCCCAGGGG + Intronic
1139584767 16:67894855-67894877 TGGATAGTCCAAAATCTCCTGGG + Intronic
1139918664 16:70444699-70444721 AGGAAAGCCCAGACTCACAGAGG - Intergenic
1139958698 16:70705519-70705541 GGGATAGTCAAGAATGTCAGAGG - Intronic
1140671321 16:77282077-77282099 TGAAAAGTCCATAATTTCAAAGG - Intronic
1141222829 16:82087746-82087768 TGGAAAGTCCAAGATCAAAGGGG + Intronic
1145881148 17:28353633-28353655 TGGAAAGTCCTGCATCCCAATGG - Intronic
1147673239 17:42189006-42189028 GGGAAAGTCCTGGAGCTCAGTGG + Intronic
1149524342 17:57342349-57342371 GAGAAAGACCAAAATCTCAGGGG - Intronic
1149533321 17:57413086-57413108 TGGAAACTCCAGAGTCTCAGAGG - Intronic
1152905801 17:82970274-82970296 TGGAAACTGCAGCCTCTCAGGGG - Intronic
1154199594 18:12290003-12290025 TGGAAAAGCCATAATTTCAGTGG - Intergenic
1157334531 18:46728451-46728473 TGGAGATTCCAGCATCTGAGTGG - Intronic
1159828740 18:73247338-73247360 TTAAAAGTTCAAAATCTCAGTGG - Intronic
1160502345 18:79408016-79408038 TGGAAATTCCAGACACTCAGGGG - Intronic
1161742981 19:6035712-6035734 TGGAAAGTCTCGAATTTCTGTGG + Intronic
1162791856 19:13067111-13067133 TGGACGCTCCAGAATCTCAGAGG + Intronic
1163737945 19:18992989-18993011 CGAAAAGTGCAGAGTCTCAGAGG + Exonic
1163917055 19:20249414-20249436 TGGTAATTCCAGAAACTTAGTGG + Intergenic
1164062235 19:21685528-21685550 TGCAAAGTCCAGGATCCCTGAGG + Intergenic
1164411089 19:28005989-28006011 TGGAAATTCCAGTATCTCCAAGG + Intergenic
1165863886 19:38924242-38924264 TGGAAGGTTCAGAATGTCAAGGG - Intronic
1165975575 19:39673462-39673484 TGTAAAGTCCAGAATCCCCAAGG + Intergenic
1166325174 19:42045392-42045414 TGGAAAGTGCAGAATGGCTGTGG - Intronic
1166438751 19:42791941-42791963 TGCAAAGTCCAGGATCCCAGAGG - Intronic
1166473765 19:43102729-43102751 TGCAAAGTCCAGGATCCCAGAGG - Intronic
1166487715 19:43227794-43227816 TTGCAAGTCCAGGATCCCAGAGG - Intronic
1166494547 19:43289666-43289688 TGCAAAGTCCAGGATCCCAGAGG - Intergenic
1202705667 1_KI270713v1_random:21844-21866 TTGAAACTCCAGAAAGTCAGGGG + Intergenic
925560514 2:5188173-5188195 TGGAAAATCCATCATGTCAGAGG + Intergenic
925578549 2:5385413-5385435 GGGCAAGTGCAGACTCTCAGAGG - Intergenic
926932013 2:18050192-18050214 TGGAAAGTCCTGAATTCCATAGG + Intronic
927409619 2:22809324-22809346 AGGAAAGACAAGAATCACAGAGG + Intergenic
927555609 2:24029208-24029230 TGGACAGTCCAGAATATAAATGG - Intronic
927739817 2:25558865-25558887 TAGAAAGTCCAGAATTTCAAAGG + Intronic
927854427 2:26518976-26518998 GGGAAAGTCCAGGAACTCCGTGG + Intronic
928238617 2:29567322-29567344 TGGAAAGGCCAGTATTTCTGGGG - Intronic
928999600 2:37333021-37333043 TGGAAAGTGCAGAGTCTCTGGGG - Intergenic
929176582 2:38983742-38983764 TAGACAGTCCAGAATCTCCCTGG - Exonic
932696655 2:73962557-73962579 TGCAAATACCAGAATCACAGAGG + Intergenic
934840737 2:97622602-97622624 AGGAAAGGCCAGAATCTATGAGG + Intergenic
940989902 2:160086401-160086423 TGCAAAGTCCAGGATCCCTGAGG - Intergenic
941153962 2:161952667-161952689 TGGAGAGTTCAGATTCACAGTGG - Intronic
942394858 2:175536337-175536359 TGGTGAGTCCAGAGTCTCAAAGG - Intergenic
942600969 2:177640738-177640760 TGTAGAGGCCAGAAACTCAGTGG + Intronic
944184078 2:196928208-196928230 TGGAAAGACCAGGATAACAGGGG + Intergenic
944326291 2:198408493-198408515 TGGAAATTCTTGTATCTCAGGGG - Intronic
945191111 2:207188461-207188483 TGGAACCTTCAAAATCTCAGAGG - Intergenic
945318216 2:208393055-208393077 TGTAAAGTCCAGAATCCCCAAGG - Intronic
945936891 2:215911727-215911749 TGGAAGGGCTAGAATCGCAGTGG - Intergenic
946213279 2:218164324-218164346 GAGAAATCCCAGAATCTCAGTGG + Exonic
947875078 2:233462438-233462460 TGGCAAGCCCAGAACCACAGAGG + Exonic
949034577 2:241810616-241810638 TGCCCAGGCCAGAATCTCAGAGG - Intronic
1169905185 20:10595566-10595588 GGGTAAGTACAAAATCTCAGTGG + Intronic
1172022519 20:31924497-31924519 GGGAAAGTCTTGAAACTCAGTGG - Intronic
1172954396 20:38745723-38745745 TAGCAACTCCAGAATTTCAGTGG + Intergenic
1175117607 20:56694187-56694209 CTCCAAGTCCAGAATCTCAGTGG + Intergenic
1175542220 20:59755014-59755036 TGGAAAGTCCAGACTTGGAGAGG + Intronic
1177503167 21:21985573-21985595 TGAAAAGTAAAGAATCTCAGAGG + Intergenic
1178022638 21:28427489-28427511 AGGAATGTCCAGAATGTCTGAGG + Intergenic
1178228345 21:30751281-30751303 TGGAAAATCCAGCATCAAAGTGG - Intergenic
1178670594 21:34588036-34588058 TGGCAAGTCCAAAATCTCCAGGG - Intronic
1181143614 22:20826926-20826948 TCTAAAGTCCAGAATCTATGAGG - Intronic
1181257169 22:21570246-21570268 TGGAATCTCCAGGCTCTCAGGGG + Intronic
1181785388 22:25223090-25223112 TTGAAAGCCCAGAAGCTCAGAGG - Intronic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1184076637 22:42183572-42183594 GGAAAAGTCCAGAGTCTTAGGGG - Intronic
1184409505 22:44318415-44318437 TGGCAAGTGCAGAATGCCAGGGG + Intergenic
949395253 3:3607855-3607877 TGGAAAGTATAGAATTCCAGTGG - Intergenic
949774845 3:7621272-7621294 TGGAGAGTCGAGAATTTCATGGG + Intronic
949896910 3:8774490-8774512 TGGGAAGTCCAAAATCACACAGG - Intronic
950214160 3:11146415-11146437 TCAAAAGTCTAGCATCTCAGGGG + Intronic
950355928 3:12409172-12409194 TTGAAAGTCCAGAATTTCAAAGG - Intronic
951738833 3:25897846-25897868 TGGAAAGTCCAAAATCTACAGGG - Intergenic
952189116 3:31003445-31003467 TGGCAAGTCCAAAATTTGAGGGG + Intergenic
954981003 3:54745246-54745268 TGGACAGTCAATCATCTCAGTGG + Intronic
955894695 3:63686778-63686800 TGGCAAGTGCAGAAGGTCAGGGG + Intergenic
957540881 3:81567334-81567356 AAGAAAGTCCAGGATCCCAGAGG - Intronic
957911059 3:86620593-86620615 TGCAAAGTCCAGGATCCCTGAGG + Intergenic
958786332 3:98600280-98600302 TGGAAAGTCCAAAATCTGCAGGG - Intergenic
958931687 3:100214453-100214475 TGGCAAGTCCAAAATCTGACAGG + Intergenic
960200316 3:114826551-114826573 TTTGAAGTACAGAATCTCAGAGG + Intronic
960498560 3:118407018-118407040 TCTAAAGTCCAGAAGGTCAGTGG + Intergenic
960773522 3:121222528-121222550 TGGAAAGCTCAGAATGGCAGAGG - Intronic
962624275 3:137210033-137210055 TGCCAAGTCCAGAATATCAGGGG + Intergenic
962909939 3:139838769-139838791 TGGAAAGTCCAGAAGGTCAAAGG - Intergenic
963583137 3:147152135-147152157 TGAAATGTCCAGATTCTCACAGG + Intergenic
964789931 3:160444469-160444491 TGGAAATTCCAGTCTCCCAGAGG - Intronic
966120257 3:176512397-176512419 TGCAAAGTCCAGGATCTCCAAGG - Intergenic
966216881 3:177513021-177513043 TGGGAAGTTCAGAACCTGAGTGG + Intergenic
971228078 4:24773335-24773357 TGGAAAGTCCAAAATCTGTAGGG - Intergenic
971318225 4:25584751-25584773 TGGGAAGACCAGAATCTCCTGGG + Intergenic
973257223 4:48125778-48125800 TGGCAAGTCCAAAATCTAACAGG + Intronic
975539571 4:75492839-75492861 TGGCTAGTCCAAAATCTCAAGGG - Intronic
976121563 4:81789246-81789268 TGGTAAGTCCAGAATCTGCAAGG + Intronic
976350016 4:84050617-84050639 TGGAATGGCTTGAATCTCAGAGG + Intergenic
979087883 4:116437423-116437445 TTGAAAGTCCATTATCTCAGAGG + Intergenic
983064448 4:163192755-163192777 TGCAAAGTCCAGGATCCCTGAGG - Intergenic
983461075 4:168026721-168026743 TGTGAAGTCCAGAATCCCTGAGG - Intergenic
983827450 4:172281368-172281390 TAGGAAGTCAAGAAACTCAGAGG - Intronic
984505620 4:180614732-180614754 AGGAAGGTCAAGAATTTCAGAGG + Intergenic
985802042 5:2010840-2010862 TGGCAAGTCCAAAATCTGTGGGG - Intergenic
985831683 5:2238572-2238594 TGGACAGTTTAGAATATCAGAGG + Intergenic
987830582 5:23089830-23089852 TGGATATTGCAGAATCTGAGAGG + Intergenic
988331112 5:29841256-29841278 TGGCAAGTCCAAAATCTCTATGG + Intergenic
988383001 5:30523588-30523610 TGGAAAAACCAGAAACTCACCGG + Intergenic
989120304 5:37998206-37998228 TGGAAAGTCCAAAAGGTGAGAGG + Intergenic
991354984 5:65759514-65759536 TGGAAAGTCCAGAATCTCAGTGG + Intronic
993249645 5:85503225-85503247 TGGAATGTTGATAATCTCAGTGG - Intergenic
993416352 5:87638305-87638327 TGATAATTCCAGAAACTCAGAGG + Intergenic
993441568 5:87962939-87962961 TGGAAAGTAGTGAATCTCACAGG + Intergenic
994293069 5:98052751-98052773 TGGATACTCCAGAAACTCAAAGG + Intergenic
995534890 5:113125216-113125238 TGGAAAGTCTAGGAATTCAGAGG + Intronic
997393814 5:133540165-133540187 TGGCAAATCCAGAATCTGATGGG - Intronic
1001135833 5:169101941-169101963 GGGAAAGGCCAGGATCTCTGAGG - Intronic
1005670079 6:28096804-28096826 TGTAAACTCCTGAATCTCACTGG + Intergenic
1008699375 6:54080273-54080295 GGGAAAGTCCAGCATGGCAGAGG - Intronic
1010083302 6:71887476-71887498 TGGGAAGTGCAGAAGCTGAGAGG + Intronic
1010824592 6:80456707-80456729 TTGAAAGTGCAGAATCTTACTGG + Intergenic
1013290524 6:108715424-108715446 TGGCATCTCCAGAAGCTCAGGGG - Intergenic
1013447360 6:110244029-110244051 TGGAAAGTTTAGGTTCTCAGCGG - Intronic
1014198304 6:118582983-118583005 TGTAAAGTCCAGGATCCCTGAGG + Intronic
1014411460 6:121127294-121127316 TGAAAAGTCCAAAATCAAAGAGG + Intronic
1014708006 6:124772296-124772318 TGGATTATCCTGAATCTCAGAGG - Intronic
1016231694 6:141813803-141813825 TGGCAAGTCCAGAATCAATGTGG + Intergenic
1016324157 6:142880521-142880543 TTAAAAGTCCAGATTCTCTGAGG + Intronic
1016873177 6:148838775-148838797 TGGAGAGTGAAGAATCACAGAGG + Intronic
1017035735 6:150265502-150265524 TGGAAAGTCCAAAATCTGTAGGG + Intergenic
1017432436 6:154384275-154384297 AGGAAATTCCAGAAACTCTGTGG - Intronic
1018274113 6:162111802-162111824 TGGAAAATCCAGCTGCTCAGAGG - Intronic
1021412341 7:20342601-20342623 TGGAAATTACAGAATCTGAGAGG + Intronic
1023313073 7:38907475-38907497 TGGAAAGTCTAGAATATCAGAGG + Intronic
1027773274 7:82433677-82433699 GGGAGATTCCAGTATCTCAGAGG - Intronic
1028322764 7:89481683-89481705 TGGAAAGTCCAGAATAAAGGAGG + Intergenic
1030453407 7:109742725-109742747 TGGTAAGTCCAAAATCTGATGGG + Intergenic
1030621775 7:111798067-111798089 TGCAAAGTCCAGGATCCCCGAGG + Intronic
1031161775 7:118177613-118177635 TTTAAACTCCAGATTCTCAGTGG + Intergenic
1031663278 7:124454024-124454046 TGGAAAGTCCAAAATCTACAGGG + Intergenic
1034706147 7:153146858-153146880 TGCCAAGTCCTGAATCTCTGTGG + Intergenic
1035177770 7:157064500-157064522 TGGAAAATCCAGAATAATAGTGG - Intergenic
1035764647 8:2096312-2096334 TGGAAGGTCCCGAAATTCAGTGG + Exonic
1035767533 8:2119309-2119331 TGGAAAATTCAGATTGTCAGAGG + Intronic
1041495026 8:58476764-58476786 TGGAACATCTAGAGTCTCAGTGG - Intergenic
1043489738 8:80737015-80737037 TGGGAGGACCAGAATATCAGGGG + Intronic
1043544766 8:81302766-81302788 TGGAAAGTCAAGATATTCAGGGG - Intergenic
1044028425 8:87203689-87203711 TTCAAAGTCCAGAATTTTAGAGG + Intronic
1045059079 8:98396556-98396578 TGAAAATTCCAGGATCTCAATGG - Intergenic
1046811745 8:118540555-118540577 TGGAAAGTTAAGAATCTCACAGG + Intronic
1048291677 8:133186064-133186086 TGGCAAGCCCTGAATCCCAGAGG + Intergenic
1048889913 8:138937593-138937615 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1050272683 9:3962712-3962734 TGTGAAGTCCAGAATTTCATGGG + Intronic
1051868470 9:21709171-21709193 TAGAAAGTACAGAATTTCATGGG - Intergenic
1052062793 9:23981763-23981785 TGGAAAATCCAGAATCCCTCTGG - Intergenic
1053205780 9:36185031-36185053 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1053453204 9:38210736-38210758 TGAGAAGTCCAGCATCTCAGGGG + Intergenic
1055987923 9:82071382-82071404 TGGCAAGTCCAAAATCTGAAGGG - Intergenic
1056566893 9:87781145-87781167 TGGAAAGTCCAAGGTCACAGAGG + Intergenic
1057194318 9:93108348-93108370 TGGAAAGCCCAGCATGTCACAGG + Intronic
1057827523 9:98382283-98382305 TGGCAACTCCAGTTTCTCAGTGG - Intronic
1058761393 9:108136833-108136855 TAGCAAGTCAAGAATCTCATGGG + Intergenic
1061582427 9:131546029-131546051 TGGAAAGTTCAGGAGCTCTGGGG + Intergenic
1187538395 X:20165426-20165448 TGGAAAGGCCAGGATCTCATGGG - Intronic
1187662116 X:21560275-21560297 CTGAAAGGCCAGACTCTCAGAGG + Intronic
1188423807 X:30023242-30023264 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1188612535 X:32117911-32117933 TGGGCAGAACAGAATCTCAGAGG + Intronic
1188984953 X:36760918-36760940 TGGAAAGTCCAGAAAGTTTGAGG - Intergenic
1189622508 X:42857192-42857214 TGGAGATTCCAGAATATAAGAGG + Intergenic
1190154761 X:47980916-47980938 TGGAAAGTCTTGATTCTCAATGG + Intronic
1192085675 X:68094857-68094879 TGGTAAGTGCAAAATCCCAGAGG - Intronic
1194560862 X:95418140-95418162 TGGCAAGTCCAAAATCTGACAGG + Intergenic
1196204215 X:112920440-112920462 TTGACAGTCCAGAAGCTCATAGG + Intergenic
1196728329 X:118917230-118917252 TGGAAGGTCCAGAAACACAGAGG + Intergenic