ID: 991356116

View in Genome Browser
Species Human (GRCh38)
Location 5:65770520-65770542
Sequence CCATATCCACAAAGATAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991356116 Original CRISPR CCATATCCACAAAGATAACT TGG (reversed) Intronic
909091820 1:71235217-71235239 GCATATTCACATAGTTAACTAGG + Intergenic
909748460 1:79128630-79128652 CAATATCCTCAAAGACAACTTGG - Intergenic
914427282 1:147588902-147588924 TAAAATACACAAAGATAACTGGG - Intronic
918582111 1:186143727-186143749 ATATTTCCACAAAGATAATTTGG - Intronic
919799340 1:201344006-201344028 CCACATACTCAGAGATAACTCGG + Intergenic
922068805 1:222170514-222170536 CCATACCCACACAGATCTCTGGG + Intergenic
922686604 1:227643594-227643616 CCAAATCCAAACAGATAAATGGG + Intronic
922894641 1:229090546-229090568 CCATCTCAGCAAAGATATCTGGG + Intergenic
1064456500 10:15492187-15492209 ACATATCCAGAAAGAAATCTGGG - Intergenic
1066626923 10:37416481-37416503 CCATATCCACAAAATTGATTTGG + Intergenic
1067205829 10:44212304-44212326 CCATATCCATAATAATACCTGGG + Intergenic
1068462608 10:57347168-57347190 CCATTGCCACAAAAATACCTAGG - Intergenic
1071894537 10:90051413-90051435 CCATACCCATGCAGATAACTTGG - Intergenic
1072085625 10:92076712-92076734 CCATATCAACAAACATGAGTAGG - Intronic
1075773720 10:124964138-124964160 CGATATACACAAACACAACTAGG - Intronic
1078004643 11:7523394-7523416 ACATATACACAAAGAATACTGGG + Intronic
1079595505 11:22240725-22240747 CAAACTCCACAAAAATAACTAGG + Intronic
1079722668 11:23838034-23838056 TCATAACCACATAGGTAACTTGG + Intergenic
1082615193 11:55350626-55350648 CCAAAAGCACAAAGATAAATGGG - Intergenic
1084990498 11:72919069-72919091 ACATATCCCCAAAGATATTTTGG - Intronic
1085356726 11:75844833-75844855 CCATCTCCACAAAAATTAGTTGG - Intronic
1086106808 11:83156486-83156508 CCACACCCACAAAAATACCTAGG - Intergenic
1086114973 11:83239588-83239610 CCATATGCAAAAAAAGAACTTGG - Intronic
1087729505 11:101762077-101762099 CCATGTCAAGAAATATAACTTGG - Intronic
1088789811 11:113214579-113214601 CCAGCTCCCCAAAGAGAACTGGG - Intronic
1090653101 11:128824122-128824144 CCCTTTCCACAAAGACCACTTGG - Intergenic
1090841242 11:130489015-130489037 CCATGCCCATAAAGATAACAGGG - Intergenic
1091124070 11:133081028-133081050 TTATATCCACAAACATAAATTGG + Intronic
1091484790 12:875235-875257 CCATATGCCCAAAGATAACATGG + Intronic
1092110494 12:5959043-5959065 CCATCTCCACAAAAATTAGTTGG + Intronic
1093398962 12:18719434-18719456 ACATATCCCCAAAGGTCACTTGG + Exonic
1099032015 12:77538245-77538267 CCATATGCACCAAAATAACCTGG - Intergenic
1101238786 12:102816971-102816993 CCAGTTCCACAAGGACAACTTGG - Intergenic
1106134996 13:26967371-26967393 CCAAGTCCACAAAGCCAACTCGG + Intergenic
1107757656 13:43642304-43642326 CCATATCAAGAAAGAAAGCTGGG + Intronic
1108238950 13:48441437-48441459 GCATATCAACAAAAATCACTTGG + Intronic
1111674521 13:91370131-91370153 ACATATCCACATAGAAAACTTGG - Intergenic
1113020055 13:105875041-105875063 CAATAACTACCAAGATAACTTGG + Intergenic
1113548774 13:111175696-111175718 CCTTATCCACAAAGAGAAGTGGG - Intronic
1114907735 14:27151603-27151625 TCATTTCCACGCAGATAACTTGG - Intergenic
1116264143 14:42665025-42665047 CAAAAGCCACAAAAATAACTTGG + Intergenic
1116309261 14:43301110-43301132 CCACATTCACAAAAATACCTTGG + Intergenic
1119566649 14:75634878-75634900 CCATAACCCCAAAGATCACCCGG - Intronic
1119779388 14:77268264-77268286 CCATATCAGAAAAGAGAACTTGG + Intronic
1122915733 14:104857666-104857688 CCAAAACCACAAACATAATTTGG - Intergenic
1123483898 15:20666331-20666353 CCATATCCACCAAGCAAACCAGG + Intergenic
1125845832 15:42852523-42852545 CCATATGCACAAAGAACATTTGG - Intronic
1127596918 15:60494018-60494040 CCATACGCTCACAGATAACTGGG + Intronic
1130407716 15:83617061-83617083 CCATTACCCCAGAGATAACTGGG - Intronic
1131688030 15:94792486-94792508 TCATATCCACAAAGTGAATTTGG + Intergenic
1133834807 16:9358464-9358486 CCATAACCACAAAGAAATCATGG - Intergenic
1137980918 16:53068814-53068836 CCATATCCTGAATGCTAACTGGG + Intronic
1143269799 17:5667088-5667110 CCTTGTCCACAAAGATGACGTGG + Intergenic
1148324845 17:46777277-46777299 CCATATCCACAGAGAAAGCCAGG + Intronic
1151089043 17:71414232-71414254 CCATATCTACAAAAATTAGTTGG - Intergenic
1153876816 18:9380586-9380608 TGATCTCCAAAAAGATAACTGGG + Intronic
1154072035 18:11161506-11161528 CCATAGGCACAAAGATAAGGTGG + Intergenic
1156797275 18:41061667-41061689 CCACCCCCACAAAGATATCTAGG - Intergenic
1159552090 18:69905657-69905679 CTTCATCCACAAAGATTACTGGG + Intronic
1159626792 18:70704396-70704418 ATATATCTACAAAGATAATTGGG - Intergenic
1159748684 18:72272573-72272595 CCAGAACTGCAAAGATAACTGGG + Intergenic
1159846974 18:73472900-73472922 GCATATTCATTAAGATAACTAGG + Intergenic
1161987047 19:7661577-7661599 CCATCTCTACAAAGATAAAAGGG - Intergenic
1162649487 19:12076081-12076103 TCATGTCTACAAAGATAACTGGG - Exonic
1167212955 19:48145067-48145089 CCATCTCTACAAAGATCAGTCGG - Intronic
1167703892 19:51066931-51066953 CCATATGCACAGAGACAACGAGG + Intergenic
1167987037 19:53327409-53327431 CTATATTCACAAATTTAACTTGG - Intergenic
925482671 2:4293402-4293424 TCATTTCCTGAAAGATAACTCGG - Intergenic
927285311 2:21351343-21351365 CAAAATGCACAAAGATTACTTGG + Intergenic
929851512 2:45595285-45595307 CCTTGGCCACAATGATAACTTGG - Intronic
929868102 2:45735318-45735340 CCATATGAACAAATATATCTCGG + Intronic
929932155 2:46266374-46266396 GCATATTCACAGAGATTACTGGG - Intergenic
930032530 2:47067334-47067356 CTATATTCACATAGATGACTTGG + Intronic
931716054 2:65029552-65029574 CCACATTCACAAGGATAAATAGG + Intergenic
932928191 2:76001502-76001524 ATAAATCCACAAAGATTACTTGG + Intergenic
933195056 2:79379825-79379847 TCATTTCCAGAAAGTTAACTAGG - Intronic
933409281 2:81904574-81904596 ACATATCTACAAAAATTACTTGG - Intergenic
935654250 2:105408353-105408375 CCAAACCCACAGAGATGACTGGG + Intronic
939986893 2:148838109-148838131 CCATAGGAACAAAGAGAACTGGG - Intergenic
941457679 2:165729379-165729401 CAATTTCCACAATGATATCTGGG - Intergenic
946774120 2:223119780-223119802 CTATATACTCAAACATAACTTGG + Intronic
1168920183 20:1526856-1526878 CCATATCCACACAGTTAATCAGG - Intergenic
1169827782 20:9788966-9788988 CACTATCCACAAAGATGTCTGGG + Intronic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170215642 20:13888558-13888580 CCTTATCCATATAGATAATTAGG - Intronic
1171139032 20:22724615-22724637 TCACATCAACAAAGATAAGTGGG + Intergenic
1178185995 21:30221148-30221170 CCATCTCCTTAAAGAGAACTAGG + Intergenic
1178197321 21:30361834-30361856 CAATAGCTACAAAAATAACTAGG + Intronic
1178846995 21:36182285-36182307 CCTGATCCCCAAATATAACTGGG - Intronic
949298472 3:2555200-2555222 ACTTATCCACAAAGGTAACCAGG + Intronic
953074946 3:39560028-39560050 CTATAACCACAAAGAAGACTAGG + Intergenic
953370117 3:42380436-42380458 CCATTTTCACCAAGAGAACTTGG - Intergenic
954722130 3:52573639-52573661 CCATATTCACTGACATAACTTGG - Intronic
955078813 3:55638898-55638920 CCATCTCCACTAAGATAAGATGG - Intronic
957756045 3:84489070-84489092 CAAAATCAACAAAGATAAATTGG - Intergenic
957837404 3:85615160-85615182 CCATAGGCACAAAGACATCTAGG - Intronic
960106626 3:113804688-113804710 CCACCTACACAAAGATAACAAGG + Intronic
960483880 3:118227189-118227211 CCATAACAACAAAAATAACAGGG + Intergenic
960766699 3:121138168-121138190 CCATATCCATTAAAAAAACTGGG + Intronic
962561193 3:136608369-136608391 CCATCTCTACAAAGTTAGCTAGG + Intronic
964321331 3:155500882-155500904 ACATGTGCACAAACATAACTTGG + Intronic
965449939 3:168825249-168825271 ACATTTCCACAAGGTTAACTTGG + Intergenic
967582467 3:191176052-191176074 CCATATCCACATTTATAATTAGG + Intergenic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
971627528 4:28941687-28941709 CTAGATCCACAAACATGACTAGG + Intergenic
971897046 4:32610406-32610428 CTATATCCCCAAAGATATATTGG + Intergenic
972864360 4:43212204-43212226 CCATATCACCAAAGACAATTTGG - Intergenic
972936985 4:44148222-44148244 CAACATCCAGAAAGAGAACTGGG + Intergenic
978365020 4:107972204-107972226 CCAGGTACACAAAGATAAGTTGG + Intergenic
978794967 4:112699967-112699989 CCATCTCCACCTAGATATCTGGG - Intergenic
979795327 4:124838998-124839020 ACATATACACAAAGAATACTAGG - Intergenic
979986114 4:127317816-127317838 CCATATCCACAAGGAAACATAGG - Intergenic
980474296 4:133291568-133291590 CCTTAACCACAAACATAAGTGGG + Intergenic
982783819 4:159519760-159519782 CCTTATCCACCGAGATAATTTGG + Intergenic
982898402 4:160964851-160964873 ACATATCCCCAAAGATGACCTGG + Intergenic
985393899 4:189520967-189520989 TCATTTCCATAAAGAGAACTAGG - Intergenic
987848314 5:23316577-23316599 CCATATCCATAGATATATCTAGG + Intergenic
987945378 5:24601340-24601362 TCATAACCAGAAATATAACTTGG + Intronic
990107504 5:52282501-52282523 CCAAAGCCATAAAGGTAACTGGG + Intergenic
991356116 5:65770520-65770542 CCATATCCACAAAGATAACTTGG - Intronic
993797077 5:92281228-92281250 CCATATACACAAATATACCATGG + Intergenic
999879588 5:155846946-155846968 CCACATCTACAAAGATGATTGGG - Intergenic
1000186757 5:158866107-158866129 CCAAGGCCACAAAGCTAACTTGG + Intronic
1000218329 5:159186518-159186540 CCATATTGCAAAAGATAACTTGG - Intronic
1000784170 5:165523419-165523441 CCATATCTACAAAAAAAAGTGGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1007787304 6:44288032-44288054 CCAAGGCCACACAGATAACTTGG - Intronic
1008417819 6:51263780-51263802 CCTCATCCACTAAGAGAACTTGG - Intergenic
1009544288 6:65004634-65004656 CCAAATTCACAGTGATAACTTGG + Intronic
1009905531 6:69866717-69866739 GCAGATGCACACAGATAACTAGG - Intronic
1009998408 6:70922961-70922983 CCATTTCCACACATATAAATGGG + Intronic
1010078829 6:71832861-71832883 ACATATCCACAATTATACCTGGG - Intergenic
1010295204 6:74187759-74187781 CCATATCAAGTAAGACAACTTGG + Intergenic
1010627598 6:78157608-78157630 CCATAACAACAAAGAATACTTGG + Intergenic
1010855034 6:80827190-80827212 CCATTTCCCCTAAGATAATTTGG + Intergenic
1012325875 6:97916830-97916852 CCATCTCCACTAAAATCACTTGG - Intergenic
1013607891 6:111767374-111767396 CAATACTTACAAAGATAACTTGG + Intronic
1014758322 6:125326751-125326773 CCATATCCACCCCCATAACTGGG + Intergenic
1015532138 6:134231202-134231224 CAAAATCCCAAAAGATAACTTGG + Intronic
1016572105 6:145525538-145525560 CCACAGCCACAAAAATATCTAGG - Intronic
1017557864 6:155592286-155592308 CCTTACCCACAAAGATTACATGG - Intergenic
1017610724 6:156183690-156183712 ACATATCTACCAAGATGACTAGG + Intergenic
1025728132 7:64087057-64087079 CCATGTCCACAAAGATAAATGGG + Intronic
1025986715 7:66459588-66459610 CCGAATCCACAAAGATAAGCTGG + Intergenic
1027477002 7:78645553-78645575 CTGTATCCATAAAAATAACTGGG - Intronic
1031706728 7:124990046-124990068 CCACATACACTAAGAGAACTGGG - Intergenic
1032278324 7:130479969-130479991 ACATATCCACAATTATAACTGGG - Intergenic
1033128926 7:138728832-138728854 CCATAACCACAAAGAAACTTTGG + Exonic
1037984277 8:23277365-23277387 CCATATAGAAAAATATAACTGGG - Intronic
1040994275 8:53386386-53386408 CTCTATCCACAAAGAAAATTTGG - Intergenic
1042890754 8:73607771-73607793 TCATATGCAGAAAGATAATTTGG - Intronic
1045340000 8:101245096-101245118 CCATTTTCAAATAGATAACTTGG + Intergenic
1048179791 8:132184317-132184339 CCAGATCCTCAAAGCAAACTCGG + Exonic
1049095018 8:140543614-140543636 CCATCTCTACAAAAATAGCTGGG - Intronic
1049318346 8:141981620-141981642 AGATATCCAGAAAGAGAACTTGG + Intergenic
1050587842 9:7131486-7131508 CCATCTCTACAAAAATATCTTGG - Intergenic
1050776567 9:9270087-9270109 CCATATACAAAAAGGTAACTAGG + Intronic
1051605757 9:18916593-18916615 CCATCTTCACCATGATAACTTGG + Intergenic
1056544753 9:87604340-87604362 CCAAAACCACAAAGATCCCTGGG + Intronic
1186171964 X:6886640-6886662 CTATCTCCACAGAGATATCTTGG - Intergenic
1186225623 X:7396106-7396128 CCATCTCCCCAAAGAGATCTTGG + Intergenic
1188285785 X:28324181-28324203 CTATATACACAGAGGTAACTAGG + Intergenic
1190795742 X:53739608-53739630 CCATAACCACAAAGATCCCCTGG + Intergenic
1194078705 X:89431065-89431087 ACATATACACAAAAATACCTAGG - Intergenic
1194165784 X:90513486-90513508 CAACATAAACAAAGATAACTAGG + Intergenic
1196064076 X:111443404-111443426 CAATATGCACAAAAATCACTTGG + Intergenic
1197604272 X:128565892-128565914 CCATATTCACACAAATAACAAGG - Intergenic
1199313573 X:146349869-146349891 CCAATTATACAAAGATAACTTGG + Intergenic
1199926280 X:152468143-152468165 CCATATCCACAAAAATGAGCCGG + Intergenic
1200431312 Y:3086187-3086209 ACATATACACAAAAATACCTAGG - Intergenic
1200512055 Y:4091283-4091305 CAACATAAACAAAGATAACTAGG + Intergenic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic
1201273487 Y:12278059-12278081 CCATCTCTACAAAAATAACCTGG + Intergenic