ID: 991360822

View in Genome Browser
Species Human (GRCh38)
Location 5:65818377-65818399
Sequence TGTATGGGGGGGTAGAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991360822_991360830 7 Left 991360822 5:65818377-65818399 CCACTTCTCTACCCCCCCATACA 0: 1
1: 0
2: 2
3: 26
4: 362
Right 991360830 5:65818407-65818429 ACCCAGTGTGTTTTTTCCTTTGG 0: 1
1: 0
2: 0
3: 23
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991360822 Original CRISPR TGTATGGGGGGGTAGAGAAG TGG (reversed) Intronic
900982193 1:6052247-6052269 TGTATTTTGGGGTAGAGATGGGG - Intronic
902191209 1:14764489-14764511 TCTATGGGGGGGCAGAGGGGCGG - Intronic
908151823 1:61310493-61310515 TGTATGGGGGGAAAAGGAAGAGG + Intronic
908354267 1:63316365-63316387 TGCACTGGAGGGTAGAGAAGAGG + Intergenic
908853195 1:68394547-68394569 TGTATGGGTGTGTAGAAGAGGGG + Intergenic
910445471 1:87295391-87295413 AGGAAGGGGGGATAGAGAAGGGG - Intergenic
910451553 1:87351755-87351777 TGTGTGGGTGGGTAGGGCAGAGG - Intergenic
910979846 1:92949144-92949166 GGAGTGGGAGGGTAGAGAAGTGG - Intronic
910988438 1:93029441-93029463 TGTATGGGCTGCTTGAGAAGCGG + Intergenic
912664147 1:111564050-111564072 TGTTTTGGGGGGTAGAGAATTGG + Intronic
915925349 1:160013916-160013938 TGGATGGGGGGGATGAAAAGAGG + Intergenic
916523812 1:165590481-165590503 TGGATGTGGGGGTAAAGGAGTGG - Intergenic
916990577 1:170239643-170239665 TGTATGGGTGGGGAGGGAGGAGG + Intergenic
917262880 1:173188896-173188918 TTTTTGAGGGGGTAGAGATGGGG + Intronic
917974754 1:180231310-180231332 GGTTTGGAGGGGTAGAGACGGGG + Intronic
919074366 1:192796080-192796102 TTTGGGGGAGGGTAGAGAAGAGG - Intergenic
919973989 1:202599143-202599165 TGTATGGGGAGGTTGAAGAGAGG - Intronic
920146984 1:203870258-203870280 AGTATTGGGAGGTGGAGAAGGGG + Exonic
920174040 1:204089178-204089200 TGCATGGGGGGGTGGGGAAGAGG + Intronic
920606933 1:207398034-207398056 TGTTTGCTGGAGTAGAGAAGGGG - Intergenic
920684027 1:208095518-208095540 TGGATGGGGAGGTGGAGCAGAGG - Intronic
921017077 1:211201992-211202014 TGGATGTGGGGGTAGGGGAGGGG - Intergenic
922334733 1:224609460-224609482 TGGATGGGGGTGTTGAGAGGTGG + Intronic
922589053 1:226759511-226759533 TGGATGGGTGGGTAGACGAGTGG - Intergenic
922978994 1:229809207-229809229 TGTATGGTGGGGTTGGGATGTGG + Intergenic
923860804 1:237890174-237890196 TGTCTGGAGGGGTGGGGAAGAGG + Exonic
1063319856 10:5042697-5042719 TGTATGGGGGGGCTGTGCAGAGG + Intronic
1065981202 10:30899644-30899666 TGTGTGGGGGGGTGGGGAGGAGG - Intronic
1066581935 10:36890730-36890752 GGTTTGGGGGCGTGGAGAAGAGG - Intergenic
1066621925 10:37364746-37364768 TGTATGGGGATGGTGAGAAGAGG + Intronic
1067081885 10:43216796-43216818 TGCATGGGGTGGCAGAGGAGGGG + Intronic
1068505175 10:57891274-57891296 TGTCTGGGGAGGAAGAGGAGGGG + Intergenic
1069952987 10:72032369-72032391 TGTGTGGGGGGGTAAAGCATGGG + Intergenic
1070551311 10:77492804-77492826 TGTATGGGAGTGGAGAGGAGAGG + Intronic
1070636736 10:78134558-78134580 TGGATGGAGGGAGAGAGAAGGGG + Intergenic
1071559705 10:86635356-86635378 TTTTTGGGGGGGTAGAGACGAGG + Intergenic
1072452924 10:95553490-95553512 AGTATTGGGGGGCAGAGGAGAGG + Intronic
1073182856 10:101595990-101596012 TGTGTGGAGGAGTAGAGAAGTGG - Intronic
1074065508 10:110008832-110008854 TGTGTTGGGGGGTGGGGAAGCGG - Intronic
1076867369 10:133174683-133174705 TGGATGGGTGGGTAGATAGGTGG + Intronic
1077128297 11:955078-955100 TGTTTGGGTGGGTAAAGTAGAGG + Intronic
1080517976 11:33040774-33040796 TGTCTGGAGGGGGAGAGGAGGGG - Intronic
1081602264 11:44503618-44503640 TGCATGGGGGGGTGGGGGAGTGG + Intergenic
1081633178 11:44703016-44703038 TGTGTGGGGGGGTGGGGAGGTGG + Intergenic
1081981772 11:47270881-47270903 TGCCTGGGGAGGTAGAGGAGGGG + Intronic
1082934548 11:58642796-58642818 TGTATGTTGGGGTAGAGATGAGG - Intronic
1083084470 11:60128577-60128599 GTTATGGGAGGGGAGAGAAGAGG - Intergenic
1083645076 11:64167358-64167380 TGTGGGGGCGGGTAGAGATGAGG - Intergenic
1083832405 11:65241371-65241393 TTGATGGGGGGGTAGAAATGGGG - Intergenic
1083914830 11:65735006-65735028 TTTTTGGGGGGGTAGAGATGGGG - Intergenic
1084445092 11:69199026-69199048 TGTATGGAGGGGTGGAGAGATGG - Intergenic
1084829809 11:71760230-71760252 TGAATGGGGGAGTAGTGAGGTGG - Intergenic
1087857879 11:103114377-103114399 TTTATGTGGATGTAGAGAAGAGG + Intronic
1088896925 11:114085561-114085583 GGTATGGGGGAGCAGAGGAGAGG + Intronic
1088972795 11:114788265-114788287 TTAATGGGAGGGTAGAGGAGAGG + Intergenic
1089013329 11:115147642-115147664 TGTGTGGGGGGGTTGGGGAGTGG + Intergenic
1089013337 11:115147680-115147702 TGTGTGGGAGGGTAGAGTATGGG + Intergenic
1089580349 11:119477794-119477816 TGTCTGGGGGTGAAGAGAGGTGG + Intergenic
1090259067 11:125305727-125305749 TGGAAGGGAGGGGAGAGAAGAGG + Intronic
1090458048 11:126866639-126866661 TGTGTGGGGGGGCAGTGAGGAGG - Intronic
1090465308 11:126928300-126928322 TGGATGTGGGGCTAGAGCAGAGG + Intronic
1091146299 11:133283135-133283157 TATTTTGGGGGGTAGGGAAGGGG + Intronic
1091773717 12:3170587-3170609 TGTGTGGGGGGGTCGTGATGGGG + Intronic
1092042215 12:5394988-5395010 TGTGAAGGGGGGAAGAGAAGAGG - Intergenic
1092967399 12:13657661-13657683 TGTGTTGGGGGGCAGGGAAGAGG + Intronic
1093639776 12:21512890-21512912 TATTTGCGGGGGTAGAGATGGGG - Intronic
1093732295 12:22579314-22579336 TGTATGTGTGTGTAGAGATGGGG + Intergenic
1094059277 12:26296435-26296457 TGTATGAGGGGGAAGAAATGGGG - Intronic
1094281656 12:28746769-28746791 TGTATGGGAGAGCAGAGAAATGG + Intergenic
1094746103 12:33346118-33346140 TGTTTGGGGAGGTGGAGAACAGG + Intergenic
1095137163 12:38618792-38618814 TGGATGGGTGGGTTGAGATGTGG - Intergenic
1095384240 12:41631391-41631413 TGTATGGGGGAGGACAGAGGAGG + Intergenic
1095473284 12:42559633-42559655 TTTTGGGGGGGGTAGAGATGGGG + Intronic
1096861563 12:54532429-54532451 TGTAGGGGGATGGAGAGAAGTGG + Intronic
1097038058 12:56137134-56137156 TGTGGGGTGGGGTAGAGGAGGGG - Intronic
1097173495 12:57129664-57129686 TGTGTTGGGGGGCAGAGAGGGGG + Intronic
1097880673 12:64683463-64683485 AGTGTGGGGAGGTAGAGAAGTGG + Intronic
1098059435 12:66544733-66544755 TGTAGGGGGTGGGAGAGAAGTGG + Intronic
1098819263 12:75208366-75208388 TGTTTGGGGAGGCAGAGAGGGGG - Intronic
1100529620 12:95451557-95451579 TGGATGGGGAGGTAGAGGAGAGG + Intergenic
1101046530 12:100812062-100812084 AGTCTGTGGGGGGAGAGAAGAGG - Intronic
1102507021 12:113390174-113390196 TGAATGGGTGGGTAGATAAATGG - Exonic
1103185970 12:118957694-118957716 AGTATGGGGGGGTGCAGCAGTGG - Intergenic
1103865503 12:124048916-124048938 TGTGTGGGTGGGTAGATAATGGG - Intronic
1104663631 12:130631619-130631641 TTTCTGGGGTGGTAGATAAGTGG - Intronic
1104878150 12:132051072-132051094 TGAATGGATGGGTACAGAAGTGG + Intronic
1104925685 12:132313045-132313067 TGGATGGGTGGGTAGATGAGTGG - Intronic
1104942699 12:132402355-132402377 TGAATGGGTGGGTGGATAAGTGG - Intergenic
1105823924 13:24105309-24105331 TATTTTGGGGGGTAGAGACGGGG + Intronic
1106085245 13:26535835-26535857 TGTATGGGGTGGTGGGGAAGTGG + Intergenic
1106179924 13:27361849-27361871 TGTGTGTGTGTGTAGAGAAGGGG + Intergenic
1107525962 13:41231454-41231476 AGTATGGGCGGGAAGACAAGAGG + Intronic
1107938552 13:45364957-45364979 TGGAGGGGAGGGTGGAGAAGTGG + Intergenic
1109640957 13:65191341-65191363 GGGATGGGGGGCTAGAGAAGGGG - Intergenic
1109925159 13:69127312-69127334 TGTGCGGGGTGGTATAGAAGCGG - Intergenic
1110452673 13:75654563-75654585 CGTGTGGGGGGTTAGAGATGGGG + Intronic
1111841789 13:93458426-93458448 TATATGGGGGGGTAGGGAGGAGG - Intronic
1112306786 13:98281550-98281572 TGTATGGGAAGGTAGAGACATGG - Intronic
1113595152 13:111526153-111526175 TGAATGGGTGGGTGGAGGAGTGG + Intergenic
1113971888 13:114197566-114197588 TGTCTTGGGGGGAAGGGAAGTGG + Intergenic
1114754980 14:25248750-25248772 TGCATGGGGTGGGAGAAAAGGGG - Intergenic
1114915499 14:27259293-27259315 TTAATGGGGTGGTAAAGAAGAGG - Intergenic
1116883005 14:50190962-50190984 TCTCTGGTGGGGAAGAGAAGAGG - Intronic
1119120754 14:72074368-72074390 TGTAGGGGTGGGTAGAGACAGGG + Intronic
1119909657 14:78337996-78338018 TGGATGGGGGGATGGAGAATGGG + Intronic
1121209765 14:92199492-92199514 GGTATGAGGAGGAAGAGAAGAGG + Intergenic
1121637814 14:95465686-95465708 TGTGTGGGTGGATAGTGAAGGGG + Intronic
1121908645 14:97769490-97769512 TTTATGGGGCGGGGGAGAAGCGG + Intergenic
1122958435 14:105083512-105083534 TGGAGGGGTGGATAGAGAAGTGG - Intergenic
1122958502 14:105083755-105083777 TGGATGGGTGGATAGAGGAGTGG - Intergenic
1123678160 15:22733859-22733881 TGAATTGGGGTCTAGAGAAGGGG + Intergenic
1124330355 15:28808126-28808148 TGAATTGGGGTCTAGAGAAGGGG + Intergenic
1126066812 15:44832060-44832082 TATATGAGGGTGTAGAGCAGGGG - Intergenic
1126093019 15:45068495-45068517 TATATGAGGGTGTAGAGCAGGGG + Intronic
1126808667 15:52378989-52379011 TGTATGGGACAGTAGAGAAATGG - Intronic
1126859490 15:52870292-52870314 TGTATGGTGATGGAGAGAAGGGG + Intergenic
1128455877 15:67831077-67831099 TGTATGTGTGGGTAGAGCATGGG + Intronic
1128566504 15:68704020-68704042 TGTATGTGTGTGTAGAGAAAGGG - Intronic
1128632438 15:69280389-69280411 TGTGTGGGGGGGTGGTGATGGGG - Intergenic
1128715983 15:69908318-69908340 TGGCTGAGTGGGTAGAGAAGTGG - Intergenic
1128759371 15:70205114-70205136 TGGAGGGAGGGGTAGGGAAGGGG + Intergenic
1130707101 15:86243621-86243643 TTTAGGGTGGGGTAGAGGAGAGG + Intronic
1132611600 16:819468-819490 TGGAGTGGGGGGTGGAGAAGGGG + Intergenic
1133074813 16:3271784-3271806 TGTGAGGGAGGGTAGAGATGGGG - Intronic
1133111593 16:3551184-3551206 TGGATGGGTGGGTAGATGAGTGG - Intronic
1133403473 16:5505419-5505441 TTTATAGGGTGGTAGAGAATTGG + Intergenic
1134200179 16:12191476-12191498 TGAGTGGGGGAGGAGAGAAGGGG - Intronic
1134600293 16:15528607-15528629 TGTATCGGGGGGTGGGGAGGTGG - Intronic
1135932415 16:26749668-26749690 TGTGTGAGGGGCTGGAGAAGGGG - Intergenic
1137002135 16:35238397-35238419 GGTATTTGGGGGTAGAGATGAGG + Intergenic
1137434615 16:48445265-48445287 TGTGTGGTGGGGGAGTGAAGGGG + Intronic
1137715685 16:50596984-50597006 TGAATGGGGAGGAACAGAAGGGG + Intronic
1138197042 16:55059456-55059478 TGGTTGGTGGGGAAGAGAAGGGG + Intergenic
1138462483 16:57159108-57159130 TGCCTGTGGGGGTAGAGAACTGG + Intronic
1138903056 16:61297353-61297375 ATTATGGGAGGGGAGAGAAGAGG + Intergenic
1138931251 16:61659611-61659633 TGTACGGTGGGCTAGAGAAAGGG - Intronic
1139594246 16:67948839-67948861 GGTGTGGGGGGGTGGACAAGAGG + Intronic
1139913553 16:70414018-70414040 TGTGGTGGGGGGTAGAAAAGTGG + Intronic
1140137712 16:72222462-72222484 GGTCTGGGGGGATAGAGCAGTGG + Intergenic
1140224954 16:73069589-73069611 TTTTTTGGTGGGTAGAGAAGGGG + Intergenic
1141378303 16:83551925-83551947 TGGATGGATGGGTAGATAAGTGG + Intronic
1141488195 16:84354986-84355008 TGGATGGGTGGGTGGAGGAGTGG + Intergenic
1141601246 16:85127685-85127707 TGTCTGTGGTGGTGGAGAAGGGG - Intergenic
1142254414 16:89006919-89006941 TGGAGGGGGAGGTAGAGGAGCGG - Intergenic
1143890763 17:10100639-10100661 TGGATGGGGGGGTTGGGAGGTGG - Intronic
1143978102 17:10845072-10845094 TGTATGGGGAGGTGGGGACGGGG + Intergenic
1144163543 17:12584902-12584924 TGTATGGCAAGGTAGAGAGGTGG + Intergenic
1145903756 17:28505469-28505491 TGTCTGTGGGGGTGGAGATGGGG - Intronic
1146242169 17:31240214-31240236 TGTAGTGGGGGGTGGGGAAGGGG - Intronic
1147134129 17:38425531-38425553 TATGTGAGGGGGTAGAGGAGAGG - Intergenic
1147182839 17:38697574-38697596 TGTCTGTAGGGGTGGAGAAGGGG - Intergenic
1147560751 17:41507451-41507473 TGTTTTCTGGGGTAGAGAAGCGG + Intergenic
1147844096 17:43392896-43392918 TCTAGGGGTGGCTAGAGAAGGGG - Intergenic
1148009197 17:44461874-44461896 TGTAGGGGGAGATAGAGATGGGG + Intronic
1148883187 17:50748494-50748516 TTTTTGGGGGGGTAGAGATGGGG + Intronic
1151006582 17:70444451-70444473 AGTATGGGGTAGTAGAGAGGAGG + Intergenic
1151192929 17:72411882-72411904 GGCAAGGGGGTGTAGAGAAGAGG + Intergenic
1151487131 17:74407970-74407992 TGAATGGGGTGGTGGAGAAAGGG - Intergenic
1151992119 17:77582107-77582129 CGTATGGGTGGGAAGAGAGGGGG + Intergenic
1152013713 17:77735963-77735985 CGGATGGGGGAGAAGAGAAGGGG + Intergenic
1153073583 18:1134983-1135005 TGGATGGAGAGGTAAAGAAGTGG - Intergenic
1153227291 18:2908515-2908537 TGGATGGGTGGGTGCAGAAGTGG - Intronic
1153996380 18:10445568-10445590 TCTATGGTGGGTTAGGGAAGCGG - Intergenic
1154970938 18:21408873-21408895 TGTCTGTGGGTGTGGAGAAGTGG + Intronic
1155572209 18:27207510-27207532 TGTGTGGGGGGGTGGGGATGGGG - Intergenic
1155782379 18:29852457-29852479 GTTATGGGAGGGAAGAGAAGAGG - Intergenic
1155979275 18:32163858-32163880 TGGGTGGGGGAGGAGAGAAGGGG + Intronic
1156169813 18:34469164-34469186 ACTATGGGGGGATAGAGAAAAGG - Intergenic
1156253585 18:35375270-35375292 TTTTTGGTGGGGTAGAGATGGGG - Intronic
1156921667 18:42529765-42529787 TGTATGGAGGAATAGATAAGGGG + Intergenic
1157747268 18:50146880-50146902 TGGAAGTGGGGGTAGAGAAAGGG + Intronic
1158504351 18:58032953-58032975 TGCATGGGGGAGAAGAGAACAGG - Intergenic
1160687398 19:443191-443213 TGGATGGGTGGGTAGATGAGTGG + Intronic
1160958311 19:1705570-1705592 TGGATGGGTGGGTAGATGAGTGG + Intergenic
1161510007 19:4665027-4665049 TGAATCGGGAGGTACAGAAGAGG - Intronic
1162447225 19:10730925-10730947 CCTATGGGGCGGTAGACAAGAGG + Intronic
1162547394 19:11339065-11339087 TTTAAGGAGGGGAAGAGAAGAGG + Intronic
1165271486 19:34711541-34711563 TGAATGAGGAGGTAGAGAGGAGG + Intergenic
1165617294 19:37213126-37213148 TGTAGGGAGGGCTGGAGAAGTGG + Intronic
1166383548 19:42368431-42368453 TGTATGGGGGGGAGGGGATGGGG - Intronic
1166420419 19:42632139-42632161 TGTATTGGGGGGGAAAGATGGGG + Intronic
1166949017 19:46413947-46413969 TATATGCGTGGGTAGAGAAATGG + Intergenic
1167009225 19:46795956-46795978 TATATTTGGGGGTAGAGACGGGG - Intergenic
1168344008 19:55641684-55641706 TATATGGGGGGCGAGAGAAAAGG + Intronic
1168605963 19:57760140-57760162 AACATGGGGGGGTAGGGAAGGGG - Intergenic
925902093 2:8515956-8515978 TGTGTGGGGAGGTGGAGGAGGGG - Intergenic
925956954 2:8976027-8976049 TGTCTGGGGAGGAAGAGGAGAGG - Intronic
926744401 2:16138986-16139008 TGCATGAGGGGGGAGGGAAGGGG + Intergenic
928440660 2:31289379-31289401 TTCATGGGAGGGTGGAGAAGAGG - Intergenic
929313352 2:40450966-40450988 TGGTGGGGGGGATAGAGAAGAGG + Intronic
930696913 2:54420902-54420924 TGCATTGGGGGGTAGAGCTGTGG - Intergenic
931747880 2:65306770-65306792 TTTATTGGGGAGTAGAGAGGGGG - Intergenic
934969499 2:98751474-98751496 GTTATGGGAGGGAAGAGAAGAGG - Intergenic
935637237 2:105258711-105258733 TGTAGGGGTGGGGAGAGAAAGGG - Intergenic
935649493 2:105370198-105370220 TTTTTGGGGGGGTAGAGACAGGG - Intronic
936493665 2:112998489-112998511 TCTGTGGGGAGGAAGAGAAGAGG - Intergenic
936636312 2:114262698-114262720 TGTATGAGGAAGTAGGGAAGAGG + Intergenic
936802648 2:116286432-116286454 TAGATGGGGAGGTAGAGGAGAGG - Intergenic
938021814 2:127912136-127912158 TGTAAGGGAGGGTGGAGAAGTGG + Intergenic
938278157 2:130046020-130046042 TGGGTGGGGGGCTAGAGGAGTGG - Intergenic
938437221 2:131291365-131291387 TGGGTGGGGGGCTAGAGGAGTGG + Intronic
939857467 2:147377479-147377501 ACTATGGGGAGGAAGAGAAGAGG - Intergenic
939906729 2:147925519-147925541 TGTGAGGGAGTGTAGAGAAGAGG + Intronic
940053829 2:149492826-149492848 TGTAGAGGGAAGTAGAGAAGTGG - Intergenic
941467595 2:165848061-165848083 TGTGTGGGTGGGTAGAGGAATGG - Intergenic
942727348 2:179025057-179025079 TGTAAGGAGCAGTAGAGAAGAGG - Intronic
943330410 2:186552082-186552104 GGTAGGGTGGGGTAGAGTAGGGG + Intergenic
943458958 2:188145770-188145792 TGTTTGGGGTGGAAGTGAAGGGG + Intergenic
944239645 2:197473379-197473401 TGGGGGGGGGCGTAGAGAAGGGG - Intronic
944675804 2:202033739-202033761 TGAATGGGGGGGGAGGGGAGGGG + Intergenic
945842051 2:214898963-214898985 TGTGTGGGTGGGTAGGGGAGGGG - Intergenic
1168835104 20:872707-872729 TGAAGGGGGAGGGAGAGAAGAGG + Exonic
1168877845 20:1183706-1183728 TGTATGGGAGGGTGGAGGACAGG + Intronic
1168934815 20:1655505-1655527 TTTATCGGGGGCTAGAGAGGGGG + Intronic
1170441252 20:16381189-16381211 TGTATGGGGGGGCAGGGTGGAGG - Intronic
1170825403 20:19790389-19790411 TGTATGTGGGTTTAGGGAAGGGG + Intergenic
1172067492 20:32232088-32232110 TGTCTGGGGTGAAAGAGAAGGGG - Intronic
1172151329 20:32792582-32792604 TGAATGGGGGGGTGGGGAGGAGG - Intronic
1172307680 20:33892923-33892945 TGCATGGGATGGTAGAGATGAGG - Intergenic
1172480007 20:35265705-35265727 TTTTTGGGGGGGTAGAGACAGGG - Intronic
1173106900 20:40145259-40145281 AGTATGGAGGGGTATAGAGGGGG - Intergenic
1173791129 20:45828420-45828442 TGTATGGAGGGATGGAGGAGAGG + Intronic
1173974734 20:47178758-47178780 TGAATGTGGGGGTAGATAGGTGG + Intronic
1174856608 20:54051410-54051432 TGTATTGGGGGGAGGTGAAGAGG + Intronic
1175735956 20:61387147-61387169 TATTAGGGGGGTTAGAGAAGAGG - Intronic
1175788911 20:61729406-61729428 TGTATTGGGAGATACAGAAGAGG - Intronic
1176087044 20:63302114-63302136 TGTAGAGGGGGGTTGAGGAGAGG - Intronic
1178446507 21:32648268-32648290 AGTTTGGGGGGAAAGAGAAGAGG - Intronic
1182116703 22:27760762-27760784 TTGATGGGAGGGCAGAGAAGGGG - Intronic
1182727623 22:32460543-32460565 TGGATGGTGGGGTATAGAGGGGG - Intronic
1183640746 22:39090901-39090923 TTTCTGGGGGGGTAGGGAGGAGG + Intergenic
1184171025 22:42759899-42759921 TGGATGAGGGGGTGGAGCAGGGG - Intergenic
1203276300 22_KI270734v1_random:89321-89343 TGGATGGGGAGGGAGAGGAGGGG + Intergenic
1203304604 22_KI270736v1_random:100476-100498 TGGAAGGGAGGGGAGAGAAGTGG + Intergenic
949796419 3:7856093-7856115 TTATTGTGGGGGTAGAGAAGAGG - Intergenic
950294615 3:11818187-11818209 TGTCAGGGGGAGTAGAGAGGTGG + Intronic
950743885 3:15071612-15071634 TGTATAGGGGTGTGGAGATGGGG - Exonic
951728072 3:25782414-25782436 GGTGTGGGGGGGTAGGGAAATGG - Intronic
952227085 3:31389266-31389288 TGGATGGGTGGCAAGAGAAGGGG + Intergenic
952767775 3:36969792-36969814 GGAATGGGGGAGAAGAGAAGTGG + Intergenic
953146348 3:40279309-40279331 TGTTTGGTGGGGTAGAGGAAAGG + Intergenic
953383365 3:42490602-42490624 GGAATGGGTGGGTAGAGAAAGGG + Intronic
953998595 3:47538867-47538889 TGTATGTGTGTGTAGAGATGGGG - Intergenic
954025431 3:47779642-47779664 TGTTTGGGTGGGTAGGGAAGTGG - Intronic
954436372 3:50498498-50498520 TGTGTGGAGGGGTGGAGGAGAGG - Intronic
954911406 3:54113892-54113914 TGCATGGAGGGGCAAAGAAGGGG - Intergenic
955038588 3:55292888-55292910 TTTATGGGGGAGAAGTGAAGAGG - Intergenic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
956748312 3:72327093-72327115 TGGATGGAGGGATAGATAAGTGG - Intergenic
958653463 3:96970219-96970241 TGTATGAAGAGGCAGAGAAGAGG - Intronic
959010065 3:101064950-101064972 TGAATGGGTGGTTAGAGAAAAGG + Intergenic
959178463 3:102948207-102948229 TGTATGTGTTAGTAGAGAAGAGG - Intergenic
960071307 3:113434260-113434282 ATGATGGGGGGTTAGAGAAGAGG + Intronic
961479756 3:127172122-127172144 GGTATGGGGAGGGAGAGCAGAGG + Intergenic
961583207 3:127900462-127900484 TTTTTGGGGGGGTGGAGGAGGGG + Intergenic
962563257 3:136630380-136630402 AGGGAGGGGGGGTAGAGAAGGGG + Intronic
963067400 3:141274436-141274458 TGTGTGGAGGGGAAGAGGAGAGG - Intronic
963096661 3:141549365-141549387 GGTATGGGTGGGCAGAGATGAGG - Intronic
963716136 3:148806096-148806118 GTTATGTGGGGGAAGAGAAGAGG - Intronic
964553479 3:157910666-157910688 TGTTTGCAGGGGTAGAGAAGAGG + Intergenic
964979847 3:162665549-162665571 TTGCTGGTGGGGTAGAGAAGGGG - Intergenic
965520204 3:169662980-169663002 GGGGTGGGGGGGAAGAGAAGAGG - Intronic
965607651 3:170512579-170512601 GGTGTGGGGGAGTAGAAAAGGGG - Intronic
966057501 3:175713870-175713892 GGAGTGGGGGGCTAGAGAAGGGG - Intronic
966495587 3:180576735-180576757 ATTATGGGGAGGTGGAGAAGTGG - Intergenic
966706883 3:182925963-182925985 TGTGTCGGGGGGTAGAGTGGAGG - Intergenic
968539351 4:1155570-1155592 TGTGTGAGGAAGTAGAGAAGTGG - Intergenic
968639941 4:1709031-1709053 TCTACGGGTGGGTACAGAAGAGG - Intronic
969701282 4:8769181-8769203 TGGATGGGGGCGAAGAGAGGTGG + Intergenic
972561301 4:40231424-40231446 TGAATGAAGGGGAAGAGAAGTGG - Intronic
973271126 4:48264329-48264351 TTTTTGCTGGGGTAGAGAAGGGG - Intronic
974064366 4:57064164-57064186 TTTTTGGAGGGGTAGAGATGGGG - Intronic
976469528 4:85411785-85411807 TGAATGGGAAGCTAGAGAAGAGG - Intergenic
977449083 4:97171564-97171586 TGTGTTGGGGGGAATAGAAGGGG - Intergenic
980096610 4:128497861-128497883 TGTAGGGGGAAGTAGGGAAGAGG - Intergenic
981677015 4:147353968-147353990 TGTCTCATGGGGTAGAGAAGTGG + Intergenic
982053336 4:151525501-151525523 AGTATTGGGGGACAGAGAAGGGG + Intronic
983806341 4:171997991-171998013 TGTTTTGGGAGGCAGAGAAGAGG + Intronic
984362474 4:178753387-178753409 TGTGTGGGTTGGGAGAGAAGAGG - Intergenic
985271988 4:188202526-188202548 TGTATTGGAGGCAAGAGAAGAGG - Intergenic
985837443 5:2281270-2281292 TGAATGGGTGGGTGGACAAGTGG + Intergenic
985837519 5:2281546-2281568 TGAGTGGGTGGGTAGACAAGTGG + Intergenic
986650066 5:9954347-9954369 GGTATGGGGGCGGAGAGAAGTGG + Intergenic
991360822 5:65818377-65818399 TGTATGGGGGGGTAGAGAAGTGG - Intronic
991450618 5:66747133-66747155 TGTATGTGTGTGTAGAGAAAAGG + Intronic
992780772 5:80124927-80124949 TGGAGGGGAGGGGAGAGAAGAGG + Intronic
993611277 5:90057534-90057556 TGAATGTGGGGGGCGAGAAGGGG + Intergenic
994732670 5:103511842-103511864 TCTATGGGGTGGGAGAGAGGTGG + Intergenic
995057518 5:107776654-107776676 TGTGTGGGGGCGTGGAGAAAGGG - Intergenic
995603692 5:113827519-113827541 TACATGGGTGGGTAGAGGAGAGG + Intergenic
996198552 5:120641039-120641061 AGTATGGGTGGGGAGAGGAGAGG + Intronic
997055482 5:130438497-130438519 TGTCTGGGGGTGGAGTGAAGAGG + Intergenic
998158817 5:139801592-139801614 TGTATGGAGGAGTGGAGATGGGG - Intronic
998407912 5:141884220-141884242 TGTATGGGGTGGTAAACGAGAGG + Intergenic
998447898 5:142212368-142212390 TCTTTGAGGGGGTAGAGAAGAGG - Intergenic
999860511 5:155640628-155640650 TGTGTGTTGGGATAGAGAAGGGG + Intergenic
1001213686 5:169835186-169835208 TGTATGGGAGGGAGGAGAAATGG + Intronic
1001242621 5:170081794-170081816 TGAATGGGTGGGTAGAGGAGGGG - Intronic
1001608431 5:172980826-172980848 TGTATGTGTGTGTAGAGATGGGG - Intergenic
1001657302 5:173361496-173361518 TCTGTGGGTGGGAAGAGAAGTGG + Intergenic
1001791117 5:174458649-174458671 TGTGTGGGGAGGTAGGGAGGTGG - Intergenic
1002642930 5:180639128-180639150 TGCATGGGTGGGTGGAGGAGTGG + Intronic
1002642963 5:180639272-180639294 TGCATGGGTGGGTGGAGGAGTGG + Intronic
1002773669 6:310319-310341 GGGATGGGGGTGTAGGGAAGTGG + Intronic
1002939473 6:1703568-1703590 TTTATTGGGGAGTAGGGAAGAGG - Intronic
1004321674 6:14636147-14636169 TGGATGGGTGGGTAGCGATGGGG - Intergenic
1005778168 6:29160250-29160272 TGTATGTGGGAAGAGAGAAGTGG + Intergenic
1005958750 6:30682225-30682247 GGAGTGGGGGGGTAGAGAGGGGG + Intronic
1006266471 6:32929182-32929204 GGTATGGGATGGTAGGGAAGTGG + Intergenic
1006451976 6:34110643-34110665 TGTAAGGTGGGGATGAGAAGGGG - Intronic
1009035445 6:58112330-58112352 GGTATGGGGAGGTAGGGAAGTGG - Intergenic
1009211260 6:60865922-60865944 GGTATGGGGAGGTAGGGAAGTGG - Intergenic
1010503791 6:76632093-76632115 TGGATGGGGAGCCAGAGAAGGGG + Intergenic
1010831249 6:80532548-80532570 TGGGTCTGGGGGTAGAGAAGTGG - Intergenic
1010851419 6:80782285-80782307 TGTATGTGGTGGTGGGGAAGGGG + Intergenic
1011989112 6:93490322-93490344 CATATGGAGGGGGAGAGAAGAGG + Intergenic
1014443688 6:121502073-121502095 TTTGTGGGAGGGTAGAGAACTGG + Intergenic
1015904776 6:138106221-138106243 TGTGTGTGGGGGTGGAGATGGGG - Intronic
1016259843 6:142155722-142155744 AGTGTGGTGGGGAAGAGAAGAGG - Intronic
1016463941 6:144307317-144307339 TGTTTGGGGAGGGAGAGAAGAGG + Intronic
1017175931 6:151504931-151504953 TGAGTGGAGGGCTAGAGAAGTGG + Intronic
1017821654 6:158053610-158053632 TGGATGGGTGGGTAGATAGGTGG - Intronic
1018205813 6:161436221-161436243 GGGATGGGAGGGCAGAGAAGAGG + Intronic
1018992567 6:168685217-168685239 TGGAAGGAGGGGGAGAGAAGGGG + Intergenic
1019467450 7:1197174-1197196 TTTTTGGGGGGGTAGAGAGTGGG + Intergenic
1019567262 7:1690477-1690499 TGAGTGGGTGGGTAGATAAGTGG + Intronic
1019567294 7:1690640-1690662 TGAATGGGTGGGTGGAGAGGTGG + Intronic
1020282199 7:6655352-6655374 TGCAAGTGTGGGTAGAGAAGAGG - Exonic
1021896407 7:25240098-25240120 TGTGTGTGGGTGGAGAGAAGAGG + Intergenic
1022030458 7:26487699-26487721 TGTATGTGGGGGTAGGGCAAGGG - Intergenic
1022527843 7:31049837-31049859 TGGGTGGGGAGGCAGAGAAGAGG + Intergenic
1023149275 7:37184733-37184755 TTTTTTGGGGGGTAGAGATGGGG - Intronic
1023961319 7:44928751-44928773 TGTATGAGAGGGTAAAGAACAGG - Intergenic
1025712396 7:63925438-63925460 TGTGTGGGGGGGCAGAGAAGTGG + Intergenic
1026366746 7:69655917-69655939 TGTATGGGGCAGAGGAGAAGAGG + Intronic
1026385862 7:69847089-69847111 TGTACTGGGGGGTAGGGGAGAGG - Intronic
1026411978 7:70132760-70132782 TGTATGTGGGGGTAGGGAAGTGG + Intronic
1026445726 7:70483035-70483057 TGTGTGGGGGGTTGGAGATGGGG + Intronic
1027768401 7:82375448-82375470 AGTATGGGGGTGTAGAAATGGGG + Intronic
1028951272 7:96637907-96637929 GGTGAGGGTGGGTAGAGAAGAGG - Intronic
1029145509 7:98443013-98443035 TATTTTGGGGGGTAGAGATGGGG + Intergenic
1030053081 7:105556403-105556425 AGTATTGGGGGGCAGAAAAGAGG - Intronic
1030730654 7:112983864-112983886 GGTATGGGAGGGTGGAGAAAGGG - Intergenic
1032872102 7:135997210-135997232 TATTTTGAGGGGTAGAGAAGGGG - Intergenic
1033004955 7:137551610-137551632 TGTCTGTGGGGTTGGAGAAGGGG - Intronic
1034349278 7:150405777-150405799 TTTATGGGGGCGGGGAGAAGGGG + Intronic
1034955271 7:155329910-155329932 TCTTTGGGGAGGGAGAGAAGAGG - Intergenic
1035330313 7:158092363-158092385 TGGATGGATGGGTAGAGAGGTGG + Intronic
1037562988 8:20091316-20091338 TGTAAGGGGGAACAGAGAAGTGG - Intergenic
1037984287 8:23277474-23277496 AGTATGGTGGGGAGGAGAAGAGG - Intronic
1038671124 8:29584096-29584118 TGGATGGGTGGGTGGAGATGAGG + Intergenic
1038995009 8:32912666-32912688 TTTTTGGGGGGGTAGAGATAGGG - Intergenic
1039062952 8:33586233-33586255 TGTATTGGGGGAGGGAGAAGAGG - Intergenic
1039269743 8:35867920-35867942 AGTAGGGAGGGGTAGTGAAGAGG + Intergenic
1041381016 8:57254481-57254503 TGTAGGGGGGTGTAGATATGGGG - Intergenic
1042046332 8:64656346-64656368 TGTCATGGGGGGTAGAGATGTGG + Intronic
1043770676 8:84195720-84195742 TGTATGACAGTGTAGAGAAGAGG + Intronic
1046254805 8:111681946-111681968 TTTGTGGGGGGGTAGGGTAGTGG - Intergenic
1049238565 8:141525137-141525159 TGTCAGCGGCGGTAGAGAAGTGG + Intergenic
1049700116 8:144007014-144007036 TGTTTGGTGGGGCAGAGCAGGGG - Intronic
1050515780 9:6442662-6442684 TTTTTGGGGGGGTAGAGATGGGG + Intronic
1050792968 9:9497082-9497104 TGTTTGGGGAGGCAGAGAATGGG + Intronic
1052812546 9:33074424-33074446 TGTGTGTGTGTGTAGAGAAGGGG - Intronic
1056177206 9:84046558-84046580 TATATGGGGAGGGAGAGAAGGGG - Intergenic
1057021581 9:91702010-91702032 TTTGTGAGGGTGTAGAGAAGAGG - Intronic
1057911355 9:99022620-99022642 TGTGTGTGGGGGAAGGGAAGTGG - Intronic
1059459070 9:114418284-114418306 TGTGTGGGGGTGGGGAGAAGAGG + Intronic
1059791573 9:117646383-117646405 TGGATGAGGGGGCAGAAAAGAGG - Intergenic
1060124493 9:121029614-121029636 TACATGGGGAGGTAGAGAATTGG - Intronic
1061528565 9:131190841-131190863 TGTAAGAGGGGGCAGAGAAGGGG - Intronic
1061846927 9:133393241-133393263 TGAATGGGAGGGTAGGTAAGTGG + Intronic
1062112306 9:134788785-134788807 TGGATGGGTGGGTAGACAGGTGG + Intronic
1062148546 9:135005000-135005022 TGAATGGATGGGTGGAGAAGTGG + Intergenic
1185458251 X:321162-321184 TGGGGGGGAGGGTAGAGAAGGGG - Intergenic
1186137004 X:6532716-6532738 TGTGTGGGGAGGGAGGGAAGTGG - Intergenic
1186297708 X:8169069-8169091 TGTGTGGGGAGGGAGGGAAGTGG - Intergenic
1186325151 X:8467402-8467424 TGTGTGGGGAGGGAGGGAAGTGG + Intergenic
1189732360 X:44034459-44034481 TGTGTTGGTGGGGAGAGAAGAGG - Intergenic
1190448320 X:50553205-50553227 TGTATGTGGGGTTTGAGGAGGGG + Intergenic
1190873085 X:54440811-54440833 TGTGTGGGGGTGTGGAGAGGAGG + Intronic
1192143504 X:68664626-68664648 TGAGTGGGGGGATAGAGAGGTGG - Intronic
1192981727 X:76351320-76351342 TGTCTGCGGTGGTAGACAAGGGG - Intergenic
1193754937 X:85397164-85397186 TATAGGAGGGGGTAGAGGAGAGG - Intergenic
1194605357 X:95972870-95972892 TCTATGGAGGGGCAGGGAAGAGG - Intergenic
1195737856 X:108032326-108032348 TGGATGGGTGGATACAGAAGCGG - Intergenic
1197992295 X:132331203-132331225 TGTCTGGGGGCTTAGAGAAGAGG - Intergenic
1198546967 X:137702400-137702422 AGTGTGGGGAGCTAGAGAAGAGG - Intergenic
1198988697 X:142485225-142485247 TGGACGTGGGGGTTGAGAAGAGG + Intergenic
1199299241 X:146193883-146193905 TGTTTGGGAGGAAAGAGAAGTGG + Intergenic
1199550664 X:149057533-149057555 TGTATGGGAAGGGAGGGAAGTGG + Intergenic
1200852828 Y:7903465-7903487 AGTATATGGGGGTAGAGAAATGG + Intergenic