ID: 991361546

View in Genome Browser
Species Human (GRCh38)
Location 5:65826192-65826214
Sequence AAGGGTTTAGAAACTTCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991361542_991361546 12 Left 991361542 5:65826157-65826179 CCATGGGAAGAGACAGGAGGCAG 0: 1
1: 1
2: 9
3: 86
4: 689
Right 991361546 5:65826192-65826214 AAGGGTTTAGAAACTTCTGCAGG 0: 1
1: 0
2: 2
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991361546 Original CRISPR AAGGGTTTAGAAACTTCTGC AGG Exonic
900376854 1:2358902-2358924 CAGGGCTGGGAAACTTCTGCAGG - Intronic
905961464 1:42045886-42045908 AAGGGTTGAGTAACTGGTGCTGG + Intergenic
909996589 1:82287538-82287560 AATGCTTAAGAAACTTCTGAAGG - Intergenic
910538886 1:88332107-88332129 AAGGCTTTAGAATCTTCCACTGG - Intergenic
911002364 1:93179968-93179990 ACCCGTTTAGAAACTTCTGGTGG - Intronic
915088882 1:153407560-153407582 AAGGCAGCAGAAACTTCTGCAGG + Intergenic
915440940 1:155945112-155945134 AATGGCTTTGAAACTTCAGCAGG + Intergenic
916307699 1:163357897-163357919 AAGGGTTTTGAAATTCCTGCAGG - Intergenic
918799663 1:188956196-188956218 AATGGTTTAGCACCTTCTCCTGG - Intergenic
922123143 1:222694991-222695013 AAGGGTTTAGAAAATTGTCATGG + Intronic
922185351 1:223269753-223269775 AAGCGTTGAGAAATTTCTGGAGG - Intronic
923318794 1:232807605-232807627 ATGAGCTTTGAAACTTCTGCTGG - Exonic
1065323629 10:24531632-24531654 AGAGGTTTAGTAACTTGTGCAGG + Intronic
1068850374 10:61731854-61731876 AAGGGTGAAGCAATTTCTGCTGG - Intronic
1070504762 10:77103505-77103527 AAGGGTATAGAAGGCTCTGCAGG + Intronic
1077279783 11:1738127-1738149 ATGGATGTAGAAACTTGTGCTGG + Intronic
1079232341 11:18659369-18659391 AAGGCAGCAGAAACTTCTGCAGG + Intergenic
1079909701 11:26294582-26294604 TAGGATTAAGCAACTTCTGCAGG + Intergenic
1080788261 11:35495688-35495710 AAGGGTTTAGAAGCCACTGCAGG - Intronic
1080969897 11:37260473-37260495 AAGGGATTAAAAACTTGTTCGGG + Intergenic
1084648158 11:70472877-70472899 AAGGGCTTTGAAACAGCTGCTGG - Intronic
1085422272 11:76372959-76372981 AAGGTTTTAGACATTTCTGCAGG + Intronic
1091471393 12:731276-731298 AAGTGTTTAGTAATTTCTGAAGG - Intergenic
1093717539 12:22400674-22400696 AAGGCAGCAGAAACTTCTGCAGG + Intronic
1094418475 12:30243448-30243470 AAAAGTTTTGGAACTTCTGCTGG + Intergenic
1095231168 12:39741912-39741934 AAGGGTTAAGTCACATCTGCAGG - Intronic
1097089243 12:56492753-56492775 AAGGATTTAGAAAAGTCTGTAGG + Intergenic
1102227743 12:111240874-111240896 CAGGGTCTAGAAAGCTCTGCAGG + Intronic
1103324463 12:120111220-120111242 AGGGGTTTCCAAACTTCTGCAGG + Intronic
1103958982 12:124595620-124595642 AAGGGCTGAGCAACTCCTGCTGG + Intergenic
1104295092 12:127504767-127504789 AAAAGTTTAGAACATTCTGCAGG - Intergenic
1104304560 12:127597783-127597805 AAGGCTTTAGAACCTCCTGAGGG + Intergenic
1105007045 12:132727974-132727996 CAGCTTTTGGAAACTTCTGCAGG - Intronic
1106508773 13:30394850-30394872 AAGAGTTTAGAATCTGCTGGAGG - Intergenic
1106816906 13:33418526-33418548 AAGGCAGTAAAAACTTCTGCAGG + Intergenic
1107153767 13:37142519-37142541 GAGGGATTGGTAACTTCTGCAGG - Intergenic
1107824980 13:44320596-44320618 AAGGGTCTAGAAACTTTTTCTGG + Intergenic
1109225280 13:59686679-59686701 AGGGGTATAGAAAGTTTTGCGGG + Intronic
1110509641 13:76334403-76334425 AAGGCTTTACATACTCCTGCAGG + Intergenic
1110815362 13:79854896-79854918 ACCAGTTCAGAAACTTCTGCAGG - Intergenic
1112344995 13:98581812-98581834 AAGGGTTCAGAATATTTTGCAGG + Intergenic
1112626254 13:101107513-101107535 ACAGGTTCAGAAACTTTTGCCGG - Exonic
1113034421 13:106033583-106033605 GAGGGTTTGGAAACTTTTGGAGG - Intergenic
1115175937 14:30561640-30561662 ATGGGTTTAAAGACTTCTCCAGG + Intronic
1117073536 14:52077866-52077888 GAGAGTTTAAAAACTTCTCCAGG - Intergenic
1118074124 14:62280069-62280091 AAGGGTTTTGAAACTTCCTCAGG + Intergenic
1119030140 14:71185937-71185959 AAGGGTTTTGAAACTACTTTGGG - Intergenic
1119982226 14:79094588-79094610 AAGGGATTAGTATCTTCTGACGG + Intronic
1120478882 14:85023902-85023924 AAGGCAGCAGAAACTTCTGCAGG - Intergenic
1123911149 15:24968210-24968232 AAAGTTTTAGAAAGTTTTGCAGG + Exonic
1124865199 15:33483587-33483609 AGGTGTTTAGAAAATACTGCAGG - Intronic
1128553793 15:68616287-68616309 AAGGGTTAAGAATCTTGGGCAGG + Intronic
1129257177 15:74340176-74340198 AAGGTTTTAGGAAGTTCTACTGG - Intronic
1129552682 15:76470582-76470604 AGGGGCTTAGAAACTTCACCAGG + Intronic
1131426878 15:92352954-92352976 AAGGTTTTGGAAACTTTTGAAGG - Intergenic
1132020293 15:98355509-98355531 TAGGGTTTACAAAATTCTGAAGG + Intergenic
1132203771 15:99972692-99972714 AAGTGTTGAGAAACTTCCGTGGG - Exonic
1132339646 15:101069994-101070016 AAGGGTCAACAAACTTCAGCTGG - Exonic
1133825210 16:9272430-9272452 AAGGGGTCAGAAACTACAGCTGG - Intergenic
1135503045 16:23013669-23013691 AATGGTTTAGCACCATCTGCTGG + Intergenic
1140568677 16:76075413-76075435 AAGGTTTTAGAATATTCTCCTGG - Intergenic
1153975232 18:10263202-10263224 AGGGGTTTAGAATCTTCAACAGG + Intergenic
1155103236 18:22634684-22634706 AAGGGTGTAGCAACTTCTGCAGG + Intergenic
1156384788 18:36595264-36595286 AAGGTTCTAGAAACATCTGGGGG - Intronic
1156421659 18:36960393-36960415 AAGGCAGCAGAAACTTCTGCAGG + Intronic
1157685268 18:49638309-49638331 AGGAGTTTAGAAACTTCTTTTGG + Intergenic
1161229694 19:3167593-3167615 AATGGTTTTGTAACTTCTGTAGG - Intergenic
1162272824 19:9630212-9630234 AAGGGCTTAGGAAATTCTGGGGG + Intronic
1164567850 19:29340770-29340792 AATGGCTTAGAAACCTATGCAGG - Intergenic
1164754206 19:30677985-30678007 CAGGGTTTAGAGACTTCTTCTGG + Intronic
1168216380 19:54929066-54929088 ATGGGTTAAGAAACTTCAGGAGG + Intronic
927129563 2:20047036-20047058 AAGGATCCAGAAACTTTTGCAGG + Intronic
931056703 2:58480466-58480488 AAGGGTTCAGAAATTTGTTCAGG - Intergenic
931274819 2:60735381-60735403 ATGGTTTTAGAAACTTCTTAAGG + Intergenic
931558510 2:63531280-63531302 AAGGCAGCAGAAACTTCTGCAGG + Intronic
933806380 2:86000959-86000981 AAGTGTTCAGACACTTCAGCAGG - Intergenic
937782761 2:125858338-125858360 AAGGGTTGAGAAAATGCTGGAGG + Intergenic
937943703 2:127311482-127311504 AAGTTTTTAGAAACTTCTGTTGG - Intronic
938975094 2:136469258-136469280 AAGGCAGCAGAAACTTCTGCAGG + Intergenic
940321763 2:152384796-152384818 AAGATTTTAGAAACGTGTGCAGG - Intronic
941158658 2:162009726-162009748 AAGGGCTTAGAAATGTCTCCGGG + Intronic
942345049 2:174994160-174994182 AATAATTTAGAAACATCTGCTGG + Intronic
943566691 2:189524645-189524667 AAGAGTATAAAAACTTCTGCAGG + Intergenic
944497570 2:200324021-200324043 AAGGGCTCAGAAACTGCTTCTGG + Intronic
944688316 2:202137223-202137245 AAGGGTTTAGTTTCTTCTGTGGG - Intronic
945569698 2:211450757-211450779 AAGGGTTTAGAGACTTATGGAGG - Intronic
946884892 2:224213238-224213260 AAGAGTTAAGAAACTTTAGCTGG - Intergenic
947223552 2:227818737-227818759 AAGTGTTTGGAAATATCTGCGGG + Intergenic
947601289 2:231452121-231452143 AAGGATGTGGAAACCTCTGCCGG - Intergenic
1169710045 20:8550814-8550836 AAGAGTTTGGAGACTTCTTCTGG + Intronic
1171294319 20:24004327-24004349 AAGTGTTAATAAACTCCTGCTGG + Intergenic
1172456257 20:35076812-35076834 AAGGCAGCAGAAACTTCTGCAGG - Intronic
1172892105 20:38272949-38272971 CAGGGATTACAAACTTCTTCTGG - Intronic
1172993985 20:39056458-39056480 GAGTGTTTTGAAACTTCAGCTGG + Intergenic
1173145659 20:40522054-40522076 TACTGTTTAGAAACTTCTGAAGG - Intergenic
1175620108 20:60436477-60436499 AAAGGCTTAGAGACTTCTCCAGG - Intergenic
1180710355 22:17835394-17835416 AAGGAGTTGGAAACTCCTGCCGG - Intronic
1182851117 22:33475132-33475154 AGGGGTTTAGAAGCTTTTTCAGG + Intronic
949273124 3:2244070-2244092 AAGGGTTCAGTACCATCTGCAGG - Intronic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
949631100 3:5927668-5927690 CATGGCTTAGAAACTTCTGAAGG + Intergenic
953228949 3:41046183-41046205 AAGGGTTTATAAATTTCCCCTGG - Intergenic
957292576 3:78295992-78296014 AAGGGTTTTGAAACCACAGCAGG - Intergenic
958479762 3:94631182-94631204 AAGGCAGGAGAAACTTCTGCAGG + Intergenic
959830062 3:110850447-110850469 AATTGTTTAGAAAATTTTGCTGG - Intergenic
961211180 3:125127219-125127241 ACAGGTTTAGAGATTTCTGCAGG - Intronic
962404029 3:135085023-135085045 AAGGGTTTAGGAACTGATTCTGG + Intronic
964830239 3:160876258-160876280 AAGGGTTTGAGAACTTCTGAGGG + Intronic
965067060 3:163863720-163863742 CAGGGATTAGAAACATGTGCTGG - Intergenic
965189637 3:165511728-165511750 GAGGATTTAGAAACTCCAGCTGG + Intergenic
971458063 4:26862013-26862035 AAGGGTGTAGAAACCTCAGCAGG + Intronic
972388741 4:38592718-38592740 AAGGGCGTAGAAGATTCTGCAGG + Intergenic
973296291 4:48524905-48524927 AAGAGTTTAGAAGCTGCTCCTGG + Intronic
974709202 4:65566657-65566679 AGGTGGTTAGAAACATCTGCTGG + Intronic
974877890 4:67720234-67720256 AAAGTTTTAGACACATCTGCAGG + Intergenic
976121493 4:81787743-81787765 AAGGATATAGAAACTTGTGCAGG - Intronic
976121555 4:81789040-81789062 AAGGGTATACAAACTTGGGCAGG + Intronic
980503937 4:133690743-133690765 AAGGCAGCAGAAACTTCTGCAGG - Intergenic
981774475 4:148349493-148349515 AAGGACTTATAACCTTCTGCAGG + Intronic
982213806 4:153063133-153063155 TAGGTTTTAGTGACTTCTGCAGG - Intergenic
984532430 4:180933285-180933307 AAGGATTTACAAACTTATGCTGG - Intergenic
987068665 5:14315086-14315108 AAGCGATTAGGAAATTCTGCAGG + Intronic
987289313 5:16493415-16493437 AAGGGTGTTGAATCTCCTGCAGG - Intronic
987396034 5:17424675-17424697 AGGGGTTTCGAAACGTCTGCAGG - Intergenic
987828979 5:23071734-23071756 AAGGTTATAGAGACTTCTGCTGG + Intergenic
989272518 5:39549768-39549790 CTGGTTTTTGAAACTTCTGCTGG - Intergenic
989943597 5:50187431-50187453 AAGGGTTTAAAAACTGCTCAAGG + Intergenic
990421090 5:55634082-55634104 AAGTGTTCAGAAACTTTTACAGG + Intronic
991361546 5:65826192-65826214 AAGGGTTTAGAAACTTCTGCAGG + Exonic
991603019 5:68372449-68372471 AAGGGTTAAGAAACTTGCCCAGG - Intergenic
992360367 5:76031840-76031862 AAGAGTTTAGCAACTTGTCCAGG + Intergenic
994102585 5:95909961-95909983 AAGGCTTTAAAAACATCTGCAGG + Intronic
994867057 5:105288506-105288528 AAGGGTTTATTAACTTTTTCAGG - Intergenic
995307617 5:110672423-110672445 AATGGTTTACAAACTTGTGTTGG - Intronic
995945421 5:117639243-117639265 AAGGGTTTACAGTTTTCTGCAGG - Intergenic
996372835 5:122771558-122771580 AAGGGTGTAGAAAGTTGTGATGG - Intergenic
996993401 5:129664981-129665003 AAGGGTTTTGAAACCGATGCCGG - Intronic
998096683 5:139399782-139399804 AGGGGTTTAGAATATTCTGGGGG + Intronic
998502283 5:142644135-142644157 AAGGGCTTTGCCACTTCTGCAGG - Intronic
999161884 5:149507771-149507793 AACCATTTAGAAACTTCTGAAGG - Intronic
1000871566 5:166583452-166583474 AAGGTGTTAGAAATTACTGCGGG + Intergenic
1001133720 5:169084963-169084985 CAGGGATTAGACACTCCTGCTGG - Intronic
1003841390 6:10124281-10124303 AAGTGCTTAGAAACTGCTACTGG + Intronic
1004963937 6:20825510-20825532 AAGTGTTTAGAAACTTTTGTAGG + Intronic
1005160844 6:22861543-22861565 AAGGGTTTAACAATTTCTGGAGG + Intergenic
1006922956 6:37638341-37638363 AAGGGTTGAGGAGGTTCTGCTGG + Intronic
1007067931 6:39011442-39011464 AAGGGATTTGAACTTTCTGCTGG - Intronic
1008526718 6:52414433-52414455 AAAGGTTAAGAAACTTCTGCAGG + Intergenic
1009225254 6:61015278-61015300 AAGGGTGTAGAACCTTCTTGTGG - Intergenic
1009263055 6:61520661-61520683 AAGTGTTTCCAAACTGCTGCTGG - Intergenic
1010878734 6:81141457-81141479 AAGGGTTTTTAAATTTCTGTGGG - Intergenic
1011146139 6:84219155-84219177 AAGAGTGTAGAACCTTCTGAGGG - Intronic
1011848027 6:91590525-91590547 AAGGCAGCAGAAACTTCTGCAGG + Intergenic
1013601529 6:111709526-111709548 AAGGTTTTAAAAACCTTTGCTGG - Intronic
1016039082 6:139413200-139413222 AAAAGTTTAGAAACTTGTCCAGG - Intergenic
1017878587 6:158544110-158544132 AAGGTTTCAGACACCTCTGCCGG - Intronic
1018109735 6:160523489-160523511 AATGGTTTAGCACCTTCTCCAGG + Intergenic
1018309098 6:162490158-162490180 AAGGGTGTAGAGGCTCCTGCAGG - Intronic
1022233110 7:28433728-28433750 AAGGGTTTAAAAATTTCTTTTGG + Intronic
1025580683 7:62711979-62712001 CAGTGTTTAGAAACTGCTGAAGG + Intergenic
1028158414 7:87458169-87458191 AATAGTCTAGAAAATTCTGCGGG - Intronic
1030024429 7:105309181-105309203 AAGGAATTAAAAACTTCTTCAGG + Intronic
1030358012 7:108564528-108564550 GAGGGTTTAGAATTTTCAGCAGG + Exonic
1030495252 7:110290498-110290520 AGTGTATTAGAAACTTCTGCAGG - Intergenic
1031142450 7:117958536-117958558 AAATGTTTAGATACTTCGGCAGG + Intergenic
1034784997 7:153917509-153917531 GAGGGTTTATAAACTTGTGAAGG + Intronic
1035287406 7:157815138-157815160 AAGGGCGCAGAATCTTCTGCAGG - Intronic
1037713731 8:21378140-21378162 AAGGGTTTAAAAACTACTTATGG - Intergenic
1038238613 8:25786443-25786465 AAGTGGTTAGAAACCTCGGCTGG + Intergenic
1040731406 8:50451739-50451761 AAAGGTTAAGGAACTTCTGTTGG + Intronic
1041800695 8:61794298-61794320 GAGGGTTTCTAAACTTCTGAGGG + Intergenic
1047474158 8:125210108-125210130 AGAGGTTTAGAAACTTATCCCGG - Intronic
1054761949 9:69012248-69012270 AAGGGTGAAGAAAAGTCTGCTGG + Intergenic
1185964440 X:4584962-4584984 AAAGGTGTAGAAAGTACTGCAGG + Intergenic
1190831988 X:54066887-54066909 AAGTGTTTACAAGCTTCAGCAGG + Intergenic
1191262228 X:58337156-58337178 AAGTGTTTCCAAACTGCTGCAGG + Intergenic
1192031936 X:67523233-67523255 AAGGTTCTAGAAACTGGTGCTGG - Intergenic
1195222587 X:102760757-102760779 AAAGGTTAAGAAACTTGTCCAGG - Intergenic
1195743896 X:108094856-108094878 CAGGGTTCAAAAACTGCTGCTGG + Intronic
1195914827 X:109925811-109925833 ATGGATTGAGAAACTTCTGTAGG + Intergenic
1199002156 X:142651916-142651938 GAGGCTTTAGTAACTGCTGCTGG - Intergenic