ID: 991361957

View in Genome Browser
Species Human (GRCh38)
Location 5:65830202-65830224
Sequence AGCCATTAGAAGAATGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991361955_991361957 7 Left 991361955 5:65830172-65830194 CCACTTTTGTGCAAGTGGTTATA 0: 1
1: 0
2: 0
3: 12
4: 220
Right 991361957 5:65830202-65830224 AGCCATTAGAAGAATGATGTGGG 0: 1
1: 0
2: 0
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991361957 Original CRISPR AGCCATTAGAAGAATGATGT GGG Intronic
906079625 1:43076215-43076237 AGCCATAAAAAGAATGAAATTGG - Intergenic
909326372 1:74355771-74355793 TGCTAGTAGAAAAATGATGTGGG + Intronic
909544668 1:76832674-76832696 TGCCATTTGAAGACTAATGTGGG + Intergenic
909769610 1:79404175-79404197 AGCCACAAGGAGAATCATGTTGG - Intergenic
910119275 1:83767681-83767703 AGGCAATAGAAGCATGATTTGGG + Intergenic
911007435 1:93241763-93241785 AGCCATTAGAAGGTTTAAGTAGG - Intronic
911303760 1:96207838-96207860 AGCCATTAGGAGAATAATAAGGG + Intergenic
911610708 1:99956603-99956625 AAATATTAGAAGAATGAGGTTGG - Intergenic
913045493 1:115070471-115070493 AAACAGTAGAAGAATGATTTGGG - Intronic
913257261 1:116964770-116964792 AGCCACTAGAACAATGGTGCTGG - Intronic
913555041 1:119957473-119957495 AGCTATTATTAGAATGATATGGG + Intronic
914499013 1:148227499-148227521 AGCCCTTTAAAGAATGAGGTAGG + Intergenic
914947887 1:152081758-152081780 CTCCATTAGAAGAGTAATGTGGG - Intergenic
916498072 1:165362953-165362975 ATCCATCAGAAGAATGAGGATGG - Intergenic
916691252 1:167192202-167192224 AGCCTTAGGAAGAAGGATGTTGG - Intergenic
918349741 1:183642385-183642407 AGCAAGTGGCAGAATGATGTGGG + Intronic
923151147 1:231234540-231234562 AGGCATGAGGAGACTGATGTAGG - Intronic
924119985 1:240787254-240787276 CACCATTAGAAGAATGAGGGAGG - Intronic
924356897 1:243188149-243188171 AGCCATTACAACAATGAAATAGG - Intronic
1064565642 10:16636312-16636334 AGCGACTTGAAGAATGATGTTGG - Intronic
1064634614 10:17351107-17351129 AGCAATTAGAAGAGAGATGCTGG - Intronic
1065905452 10:30247164-30247186 ATCCAATAGAAATATGATGTGGG - Intergenic
1066105658 10:32154649-32154671 AGCCATTATAAAAATGCTTTAGG - Intergenic
1067271335 10:44794064-44794086 AGCCATTAAAAGTATGATCCCGG + Intergenic
1069229295 10:65988620-65988642 TGCCATTAGAACATTGATTTAGG - Intronic
1070112914 10:73501820-73501842 AGCCATCAGAAGAATATTCTTGG - Intronic
1070807791 10:79280683-79280705 AGTCATCAGAAGAATGGGGTGGG - Intronic
1070911341 10:80121205-80121227 AGCAATGAGACAAATGATGTTGG + Intergenic
1072381406 10:94875395-94875417 AGCCCTGTGAAGAATGATGATGG + Intergenic
1073430475 10:103483438-103483460 AGTCATTAAAAGAATGAAGCAGG + Intergenic
1077976999 11:7257311-7257333 AGCCCTTAAAAGAAAAATGTAGG - Intronic
1080086037 11:28283482-28283504 TGCCGTTAGAAGAATGATGAAGG + Intronic
1080563189 11:33483357-33483379 AACCTTGAGCAGAATGATGTTGG + Intergenic
1081070687 11:38605675-38605697 AGCCATTAGGAGAATATTATTGG + Intergenic
1082604537 11:55209059-55209081 AGCCAAAAGAAGAATGCTGGAGG + Intergenic
1084875004 11:72124570-72124592 AGACAATTGAAGAATGATGAAGG + Intronic
1085829654 11:79885718-79885740 AGTCATTATAAGGAGGATGTAGG - Intergenic
1086247472 11:84770950-84770972 AGCCATAAAAAGAATGAAATCGG - Intronic
1086254834 11:84863228-84863250 AGCTATTAGAAGAATGAAACTGG - Intronic
1088109791 11:106247913-106247935 AGCCTCTACAAGCATGATGTTGG - Intergenic
1088843465 11:113645733-113645755 AGCCATTTCAATAATAATGTAGG + Intergenic
1089203068 11:116736833-116736855 TGCCATTAGAAGAAAGCTGCTGG - Intergenic
1089763094 11:120742930-120742952 AGCCATAAAAAGAATGAGATTGG + Intronic
1090454157 11:126833262-126833284 AGCCCTTAGAAGCATGAAATAGG + Intronic
1090856851 11:130617190-130617212 ATCAAGTAGGAGAATGATGTAGG - Intergenic
1092134738 12:6138863-6138885 TGCTAGTAGAACAATGATGTGGG + Intergenic
1093467919 12:19469225-19469247 AGCCATTAAAAGAATATTTTTGG - Intronic
1097611475 12:61827104-61827126 TGCCAATAGAAGTCTGATGTGGG + Intronic
1098505207 12:71241377-71241399 ACCCATAAGAAAAAGGATGTTGG - Intronic
1100227755 12:92575875-92575897 AGCAATTAGCAGAATTATGTGGG - Intergenic
1101082242 12:101199884-101199906 AACCTTTAGAAGAATGTTCTTGG + Intronic
1101152178 12:101893480-101893502 AGCCATTAGGAGAATGATTGGGG - Intronic
1101671409 12:106878214-106878236 AGTCATTAGATGAAAGATGAAGG + Intronic
1106755557 13:32819870-32819892 AGCCCATAGAAGAAAGAAGTAGG - Intergenic
1107594868 13:41952666-41952688 ATTTATTAGAAGGATGATGTCGG - Intronic
1107703698 13:43077168-43077190 AGACATGAGGAGAATGATTTCGG - Intronic
1109426581 13:62172240-62172262 AGCCATGACAAGAATGAAATCGG + Intergenic
1109449155 13:62485997-62486019 CACCATTAGAAAAATTATGTTGG + Intergenic
1110291698 13:73815196-73815218 ATCCACTAGAAGAGGGATGTTGG + Intronic
1112609379 13:100940923-100940945 AGTCATTAGAAGGGGGATGTAGG + Intergenic
1112641581 13:101281261-101281283 AGCAATCACAAGAGTGATGTGGG - Intronic
1114135776 14:19848013-19848035 AGTAATAAGAACAATGATGTAGG - Intergenic
1114322216 14:21556569-21556591 AGTCATTCAAAGAATGATGAGGG - Intergenic
1114769132 14:25408696-25408718 ACCAATTAGAAGGATGATGGTGG + Intergenic
1114903677 14:27099075-27099097 AGACATTGGAAGAAAGAGGTGGG + Intergenic
1116228291 14:42181717-42181739 AGGCATTTCAAGAATGATGTCGG + Intergenic
1116435434 14:44890665-44890687 AGAATTTAGAAGAATTATGTAGG - Intergenic
1117002405 14:51384093-51384115 AGCTATTATAAGAGTGATGGTGG - Intergenic
1119416142 14:74470820-74470842 AGGCAGTAGAAGCAGGATGTTGG - Intergenic
1119567768 14:75643160-75643182 AGGCATTAAAAGTATGTTGTAGG - Intronic
1119921111 14:78446958-78446980 CGCCATTTAAAGAATGGTGTTGG + Intronic
1120297881 14:82667323-82667345 AGCTATTTGAGCAATGATGTGGG - Intergenic
1122748632 14:103916632-103916654 AGCTATTGGAAGACTGAGGTGGG + Intronic
1124151668 15:27184841-27184863 AGCCATTAAAAGGATAATGGTGG - Intronic
1125407504 15:39369144-39369166 GGCTATTAGAAGCATGATGCTGG + Intergenic
1126260819 15:46688607-46688629 AGCAATTAGAATTTTGATGTGGG - Intergenic
1126919172 15:53501547-53501569 AGTTATTTGAAGAATGATGATGG + Intergenic
1127199376 15:56626566-56626588 AGTCATTTTAAGAAAGATGTTGG + Intergenic
1127281734 15:57498848-57498870 AGCCAGTAGAAGGATGGGGTGGG + Intronic
1128174192 15:65539838-65539860 AGCAAGTTGAAGAATGATATAGG + Intronic
1131778925 15:95832809-95832831 AGCACTTAGAAGAATTCTGTAGG - Intergenic
1133160858 16:3910705-3910727 AGCCACTAGGAGGCTGATGTGGG - Intergenic
1133359978 16:5166492-5166514 AGCCACTAGAAGAATCATCCTGG - Intergenic
1134875367 16:17693445-17693467 AGTGAATATAAGAATGATGTCGG - Intergenic
1138347757 16:56330392-56330414 AGCCACTAGAAGACAGATTTGGG - Intronic
1138877061 16:60965183-60965205 AGCAGATAGAAAAATGATGTTGG + Intergenic
1141997311 16:87643737-87643759 AGCCATGAGAAGCAGGATGGAGG + Intronic
1148963885 17:51418155-51418177 AGCTATTAGAAGGATGAGGTGGG + Intergenic
1152274230 17:79345272-79345294 AGCCATTAGAAGGATAATAAGGG - Intronic
1153393652 18:4592218-4592240 AGGCATTAGAAAAATGAATTAGG + Intergenic
1156107416 18:33681407-33681429 AGCAATTATAAGAATGTTTTTGG - Intronic
1156411649 18:36834420-36834442 AGCTATTAGAACAATGTTGCGGG + Intronic
1157135732 18:45053105-45053127 AGCCAACAGTAGAATGTTGTTGG + Intronic
1157887276 18:51380997-51381019 AACCTTTAGAAGAGTGATTTGGG + Intergenic
1158589133 18:58764967-58764989 AGCCAAGAGAAGAATTGTGTGGG - Intergenic
1159663688 18:71130908-71130930 ATTCTTAAGAAGAATGATGTTGG - Intergenic
1159881729 18:73864763-73864785 ATCCATTAGAAGGCTGCTGTAGG - Intergenic
1164917949 19:32066934-32066956 AGTCATTAAAAGAATGAGATAGG + Intergenic
925222478 2:2153298-2153320 AGCCATCAGAAGAAAGGTGATGG + Intronic
928559796 2:32468764-32468786 AACCATTAGAAGCATGAAGCAGG - Exonic
928986822 2:37190267-37190289 AAGCATAAGAAGAAAGATGTGGG - Intronic
930770954 2:55129983-55130005 AGACATTAGAAGTAGAATGTAGG - Intergenic
933029480 2:77309822-77309844 AGCCATTAAAATAATAATGTAGG + Intronic
933384550 2:81593415-81593437 ATCCATTAGCAGATTGAAGTAGG - Intergenic
934085354 2:88504717-88504739 AGCCATGAGAAGACTGAAGTGGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
939812019 2:146845252-146845274 AGCAATTAGAAAACTAATGTTGG - Intergenic
940537564 2:154965836-154965858 TGCCATTAAATTAATGATGTAGG + Intergenic
941735015 2:168964632-168964654 AGCAATTAGCAGAACCATGTGGG - Intronic
942288824 2:174449542-174449564 AGCCATAAAAAGAATGAAATAGG + Intronic
942962542 2:181849482-181849504 AACCTTTAGAAGAATGATTTGGG + Intergenic
945590496 2:211723384-211723406 AGCCATTTTAGGAATGATTTGGG + Intronic
946897767 2:224341957-224341979 AGCCATCAGAAGACTGAGGCAGG + Intergenic
1173704542 20:45100406-45100428 ACCCATTAGAAGCATAATATTGG + Intronic
1177496346 21:21896633-21896655 AGCCATTAAAAGAATGAAATAGG - Intergenic
1179042260 21:37814596-37814618 AGCCATAAAAAGAATGAGATCGG + Intronic
1180192644 21:46173422-46173444 AGACATCAGCAGAGTGATGTGGG - Intronic
1184914018 22:47554827-47554849 AGCCACTTAAAGAATGATATGGG - Intergenic
1184970974 22:48019623-48019645 GGGCATTACAAGAAGGATGTGGG + Intergenic
949127732 3:466535-466557 AGCCATTATAAGAATGAAATAGG - Intergenic
949448783 3:4163808-4163830 GTCTATTAGAAGACTGATGTTGG - Intronic
949502655 3:4696391-4696413 AGCCTTGAGAAAAATCATGTAGG - Intronic
949713610 3:6901297-6901319 AGCAATAAGAAGATTTATGTAGG + Intronic
949729708 3:7094388-7094410 GGCCTTTAGAAGAATGAGGCCGG + Intronic
950010564 3:9720052-9720074 AGCCATTTGATGTATGATCTGGG - Intronic
950081653 3:10226669-10226691 AGCCTTTGGGAGACTGATGTGGG + Intronic
950246545 3:11424941-11424963 ATCCATTAAAAGAATGAGGCAGG - Intronic
952551770 3:34486630-34486652 ATCCAACAGAAGACTGATGTAGG - Intergenic
953113325 3:39966012-39966034 GGCCATTAGCAAAATGATGTGGG + Intronic
955364102 3:58297207-58297229 TGTCCTTAGCAGAATGATGTCGG - Intergenic
955886062 3:63600167-63600189 CGTCATAAGATGAATGATGTTGG + Intronic
955906471 3:63813102-63813124 AGCCATTAAAAGAAGAAGGTTGG - Intergenic
956597306 3:70981809-70981831 AGCAATTAGAACAATTTTGTGGG - Intronic
958483305 3:94672843-94672865 AGCCATTACAAGAATAACATTGG - Intergenic
959841599 3:110983203-110983225 AACCATTAGAAGAGATATGTAGG + Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960558284 3:119053632-119053654 AGCTCTGTGAAGAATGATGTTGG - Intronic
960569603 3:119172890-119172912 AGCCATTAAAATAATGTTCTGGG + Intronic
961246606 3:125459333-125459355 AGCCATTTGAGAAAAGATGTAGG - Intronic
961429102 3:126867762-126867784 AGACATTAGCTCAATGATGTGGG - Intronic
961504801 3:127362919-127362941 AGCTATAAGAAGGATGATGCTGG - Intergenic
964268954 3:154934117-154934139 AGTCATCAGAAGAATGTTGCAGG - Intergenic
965356776 3:167684983-167685005 AGCCATTAGGAGAATGTGGTGGG - Intronic
966353907 3:179059039-179059061 AGCCATTAGGAGATTGTTATTGG + Intronic
971246408 4:24932891-24932913 AGCCATCAGAGCAATGATCTGGG + Intronic
971887210 4:32466130-32466152 AGCCATTAAAATAATAAGGTAGG - Intergenic
971965847 4:33554794-33554816 AGCTATTAAAATAATGATGGTGG - Intergenic
972698414 4:41470186-41470208 AGCTAAAAGAAGAATGGTGTTGG - Intronic
972701683 4:41500219-41500241 AGCCATTGGATGAAAGATCTGGG - Intronic
976410253 4:84705297-84705319 AGCAATTTGAAGGAGGATGTAGG + Intronic
978260532 4:106752228-106752250 AGGCATCAGAAAAATGGTGTAGG + Intergenic
979265774 4:118701298-118701320 AGCTATTAGGAGGCTGATGTGGG - Intronic
981639589 4:146925273-146925295 AGCTATTGAAAGAGTGATGTTGG + Intronic
982364868 4:154566446-154566468 AGGCATTAGATGAAGGATTTGGG - Intronic
984551791 4:181169530-181169552 AGAAATTAGGAGAATGATTTAGG - Intergenic
984779232 4:183509113-183509135 AGCCATTAAAAGTAAGATGATGG + Intronic
986423753 5:7610122-7610144 AGTCCTCAGAAGAAAGATGTAGG + Intronic
987011409 5:13770002-13770024 AGTCAAAAGAAGAATGATGTGGG + Intronic
987526259 5:19053714-19053736 AGCCTTCTGAAGAAGGATGTGGG + Intergenic
989329040 5:40234170-40234192 GGCCATTAGCAGGATGCTGTGGG - Intergenic
990950693 5:61295487-61295509 AGCACTGAGAAGAATTATGTTGG + Intergenic
991339936 5:65597704-65597726 AGCCATTAAAAGAAAAAGGTTGG - Intronic
991361957 5:65830202-65830224 AGCCATTAGAAGAATGATGTGGG + Intronic
991654387 5:68889075-68889097 ATCCATTAAAAGAATGTTGGTGG - Intergenic
992060217 5:73036675-73036697 ACCCATTAGAAGTATAATATGGG - Intronic
992160589 5:73997083-73997105 AGTGATTAGAAGAAAGATGAAGG - Intergenic
993095862 5:83476893-83476915 AATCCTTAGAAGAATGAGGTAGG - Intronic
997265569 5:132493178-132493200 AGCCATTACAATAAAAATGTTGG - Intergenic
997895303 5:137710688-137710710 AGAGCTTAGAAGAATGATGAAGG - Intronic
998343447 5:141439683-141439705 AGCCATAATAGGAATGTTGTGGG - Intronic
998494565 5:142576459-142576481 AGCCATGAGAAGAGAGATATTGG - Intergenic
998573368 5:143286047-143286069 AGCCATTAGAAGGATATTATGGG + Intronic
998855144 5:146387486-146387508 AGCCATTATATCAATAATGTGGG - Intergenic
999538666 5:152547900-152547922 AGCCAGGAGAATAATGATGGTGG - Intergenic
1003773547 6:9335078-9335100 AGCTATTAGTAGAATGGTTTTGG - Intergenic
1007118232 6:39359479-39359501 AGCCATTAAAACAACGCTGTAGG + Intronic
1007982793 6:46176263-46176285 AGCCCTTAGAAGAATGCAGGTGG + Intergenic
1008657315 6:53629152-53629174 AGACATTATAAGACGGATGTGGG - Intergenic
1008831150 6:55764271-55764293 AGCCATAAAAAGAATGAAATTGG + Intronic
1009314401 6:62199787-62199809 AGCCAAAAGAAGAAAGATGGAGG + Intronic
1009854809 6:69248218-69248240 TGTCAATAGAAGAATCATGTTGG + Intronic
1011166736 6:84456090-84456112 AGTGATAAGAAGAATAATGTTGG - Intergenic
1011862152 6:91772235-91772257 GGCCATCAGAAGAAAGAGGTGGG - Intergenic
1012434111 6:99196809-99196831 AGCTATTAGAAGAATGTTAAAGG + Intergenic
1014121626 6:117732232-117732254 AGATATTAGAAGAATGATAATGG - Intergenic
1014217099 6:118762747-118762769 AGCCATAAAAAGAATGAAATTGG - Intergenic
1014537010 6:122626478-122626500 AGTCATAAGAAGAATGATTTTGG + Intronic
1016633891 6:146265725-146265747 AGCCATAAGGAGAATGAATTTGG - Intronic
1017277526 6:152587321-152587343 AGCCCTTGGAATAATGGTGTAGG - Intronic
1018912955 6:168114525-168114547 AGCCTTTAGACCCATGATGTGGG + Intergenic
1020801513 7:12738348-12738370 AGCCATTAAAAAAATCATGAAGG - Intergenic
1021182196 7:17519748-17519770 AGCCAGTAGAAGAGCAATGTTGG - Intergenic
1021651794 7:22839943-22839965 AGTCAGTAGAAGAAAGATGGAGG + Intergenic
1022997187 7:35768958-35768980 ACCCATTAGAAAATTGAGGTTGG + Intergenic
1024746190 7:52408993-52409015 TGCCATCAGAAAAATAATGTTGG - Intergenic
1024835744 7:53516263-53516285 AGCCATTAGAAGAAGGTTGATGG + Intergenic
1026157107 7:67836181-67836203 AGTCATTAAAATAATGATTTAGG + Intergenic
1026343594 7:69454933-69454955 AGCCATTAGAGGTATAATGCAGG - Intergenic
1027431470 7:78117904-78117926 AGCCAGGAGAAGAATAAAGTTGG + Intronic
1029028126 7:97439531-97439553 AGTAATTAGAAAAGTGATGTTGG - Intergenic
1031322106 7:120343681-120343703 AGCCATAAGTAAAATCATGTTGG + Intronic
1031803935 7:126284629-126284651 AGGCATTAATAAAATGATGTAGG - Intergenic
1031810146 7:126357475-126357497 AGCCATTTGTAGGATGATGGGGG - Intergenic
1031823773 7:126536219-126536241 AGCCACCATAAGAATGATGAAGG - Intronic
1035021229 7:155801649-155801671 AGCCATGAGAAGAAACAAGTTGG + Exonic
1040807547 8:51409978-51410000 TGCCTTTACAAGAACGATGTTGG + Intronic
1042394421 8:68276039-68276061 AGCTATTATAAGAATAATATGGG - Intergenic
1043460353 8:80453842-80453864 AGCCATTGGAAGAACGCAGTTGG + Intergenic
1044774442 8:95673802-95673824 AGCCATCAGAAGACTGTTGAAGG - Intergenic
1045689610 8:104746783-104746805 AGTCTTTAGAAGAATCATTTGGG - Intronic
1046032058 8:108794210-108794232 GGCCATTAGAAGAATAAGGCAGG + Intergenic
1046166640 8:110445358-110445380 AGACATCAGAAGAATGTTGATGG + Intergenic
1047699975 8:127439509-127439531 AGCTCTGTGAAGAATGATGTTGG - Intergenic
1048736228 8:137504915-137504937 ATCCATTACAAGAATGAGGCTGG - Intergenic
1049028184 8:140012144-140012166 AGCTTTTAGAAGAAAGAAGTGGG + Intronic
1049234069 8:141501347-141501369 AGACATTAAAAGAATAATGAAGG + Intergenic
1050341454 9:4643702-4643724 AGCTATCAAAATAATGATGTAGG + Intronic
1052397606 9:27959087-27959109 AGACATTAGAAGAATAATAAGGG - Intronic
1056066296 9:82938936-82938958 AAGGAGTAGAAGAATGATGTAGG - Intergenic
1056240456 9:84641442-84641464 AGTCATCATAAGAATGATGAAGG - Intergenic
1056927422 9:90846791-90846813 AGCCAGCAGCAGAATGCTGTGGG + Intronic
1057589524 9:96360328-96360350 AGGCATTAAAAAAATGATTTTGG + Intronic
1058939830 9:109802696-109802718 GACTATGAGAAGAATGATGTGGG - Intronic
1058983024 9:110187751-110187773 GGCAATTAGAAGAAGGTTGTTGG + Intergenic
1059302603 9:113326818-113326840 AGACAATAGAAGAATTATCTGGG - Intronic
1185720796 X:2379861-2379883 AGCAATTAGAACAATTATGAGGG + Intronic
1185819745 X:3190825-3190847 AGCCAAGAGAAGAGGGATGTGGG - Intergenic
1186231680 X:7462188-7462210 AGGCATTATAAGAATTATCTGGG - Intergenic
1186561576 X:10618952-10618974 AGACATTAAAAGTATGAGGTTGG + Intronic
1187282790 X:17873158-17873180 AGCCATTAGAAGAAAAATAAGGG - Intergenic
1189688665 X:43592503-43592525 AGCCATTAAAAGCCTAATGTAGG + Intergenic
1191023967 X:55893629-55893651 AGCCATTAGAAAAATGCTTCAGG - Intergenic
1193321444 X:80126780-80126802 AGTCATTTGAAGAATGATGATGG + Intergenic
1194569122 X:95531238-95531260 GGCCAATAGAAAAATTATGTGGG + Intergenic
1195243322 X:102974349-102974371 GGCCATTTTAAAAATGATGTTGG - Intergenic
1196730853 X:118940183-118940205 ACACATTAAAAGAATGAAGTTGG + Intergenic
1197954461 X:131931121-131931143 AGCCATTAGGAGATTATTGTTGG - Intergenic
1198442431 X:136675886-136675908 AGCCATTGCAAGAATGAGTTTGG - Intronic