ID: 991362605

View in Genome Browser
Species Human (GRCh38)
Location 5:65836551-65836573
Sequence CTGTTAGGAAGGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 1, 2: 11, 3: 62, 4: 603}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991362605 Original CRISPR CTGTTAGGAAGGAGGAAAAA GGG (reversed) Intronic
901067268 1:6500272-6500294 TTGTTGGGGAGCAGGAAAAAGGG + Intronic
902696839 1:18145878-18145900 CTTCTTGGAAGGAGGAATAAAGG - Intronic
902879729 1:19363541-19363563 CTGGGGGGAAGGAGAAAAAAGGG + Intronic
902945944 1:19838669-19838691 CAGTTAGGAAAAAGAAAAAAAGG + Intergenic
904889557 1:33769200-33769222 TTGTAAGGAAGGAAGTAAAATGG + Intronic
905154846 1:35967939-35967961 CTGTCATGAAGGATAAAAAAAGG - Intronic
905230748 1:36513719-36513741 CTGGGAGGAAAGAGCAAAAAGGG - Intergenic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906065600 1:42978258-42978280 CTGTTGGGAAGAAGGAAGGAAGG - Intergenic
906453668 1:45974948-45974970 CTTTTAGCAAGGAGGAGTAATGG + Intronic
907581668 1:55577887-55577909 ATGTCAGGAGGGTGGAAAAATGG + Intergenic
907951020 1:59184306-59184328 CTGCAAGGAAAGATGAAAAATGG - Intergenic
908117064 1:60950787-60950809 ATGATAGAGAGGAGGAAAAAAGG + Intronic
908177382 1:61569230-61569252 CTGTTAACAAGGAGGAAAGTCGG + Intergenic
908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG + Intergenic
908352941 1:63303905-63303927 GTGTTGGGGAGGAGGAAGAAGGG + Intergenic
908464516 1:64378984-64379006 CGGATAAGAAGGAGGAAGAATGG - Intergenic
908815100 1:68023630-68023652 CTGTAAGGAAGGAGGAACGAAGG + Intergenic
908954054 1:69599707-69599729 CTGCCAGCAAGGAAGAAAAAGGG - Intronic
909585144 1:77281529-77281551 CTGTGGGGAAGGGGGAAAAGGGG - Intergenic
909894997 1:81057693-81057715 GTTATAGGAAGGAAGAAAAAAGG - Intergenic
910468016 1:87521071-87521093 GGGTTAGGAAGAAGGAGAAATGG - Intergenic
910511775 1:88014774-88014796 CCGTAAGGATGGAGGAACAAAGG - Intergenic
911721610 1:101197172-101197194 CAGTCAGGAATGAGGGAAAAAGG + Intergenic
912077347 1:105891860-105891882 CTCTTAGGAAGGATGAACCAGGG + Intergenic
912462506 1:109845386-109845408 CAGATAGGAACGGGGAAAAAAGG - Intergenic
912480612 1:109979745-109979767 GTGTGAGGAAGCAGGAAAACTGG - Intergenic
913494542 1:119416402-119416424 CTGTGAGGAAGGTAGAAAAGGGG + Intronic
914387887 1:147189382-147189404 GTGAAAGGAAGGAGGAAAATAGG + Intronic
914783711 1:150809175-150809197 ATGTGGGGAAGGAGAAAAAAAGG + Intergenic
914985898 1:152457032-152457054 ATGGCAGGAAGGAGGACAAAAGG + Intergenic
915008952 1:152666730-152666752 CAGGTAGGAAGAAGGAGAAAGGG + Intergenic
915045336 1:153008696-153008718 ATGTCAGGCAGGAGTAAAAAGGG + Intergenic
915646826 1:157278543-157278565 CTGTTAGGAAGGAGGAAAATCGG + Intergenic
915923656 1:159998684-159998706 TTGTCAGAAAGGAGGAAAAGGGG + Intergenic
916522837 1:165580689-165580711 CTGCTAGGAAGAAGGAGAACTGG - Intergenic
916591235 1:166192933-166192955 CTGTTATGAAGAAAGTAAAATGG + Intergenic
916974402 1:170060169-170060191 CAATCAGGAAGGAGAAAAAAAGG + Intronic
917223502 1:172757279-172757301 ATGTTAGGAAAGGGGAAAACAGG + Intergenic
917871522 1:179246483-179246505 AAGTTAGGCAGCAGGAAAAAAGG + Intergenic
917962917 1:180158577-180158599 CTGTCAGCAAGGAGGAAGGAAGG + Intronic
918092213 1:181307369-181307391 CTGATAGGAAGGAGGTAAGCTGG + Intergenic
918197998 1:182240695-182240717 GTGTTAGGAAGGAAGAACATAGG - Intergenic
919307038 1:195855517-195855539 CAGGTAGAAAAGAGGAAAAAGGG + Intergenic
919790213 1:201285720-201285742 CCGATAGGTAGGAGGAAAAAGGG - Intronic
920003191 1:202813101-202813123 CTGCCAGGAAAGAGGAAAAAGGG - Intergenic
920158921 1:203980319-203980341 CTCTTAGAAAGGGGGAATAAAGG - Intergenic
920340886 1:205274482-205274504 CTGAAAGGGAGGAGGAAAAAGGG + Intergenic
920581367 1:207111193-207111215 GAGTTAGGAAGGAGGATAATGGG + Intronic
920827556 1:209435834-209435856 CTGACAGGCAGCAGGAAAAATGG - Intergenic
921672220 1:217938245-217938267 CTGTTTGGAAGAGGGGAAAAAGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923099495 1:230801057-230801079 CTGTTGGGAAGGAGGAGGCAGGG + Intronic
924070179 1:240269213-240269235 CTTTTATGAAGGATGAAATAAGG + Intronic
924090724 1:240498271-240498293 CTTTCAGGAAGGGGGAAAAGTGG + Intronic
924213213 1:241791820-241791842 AAGTTAGGAAGTAGGAGAAAAGG + Intronic
1062996692 10:1872814-1872836 CTGTTAGGCTGGTGAAAAAAGGG + Intergenic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063319223 10:5037128-5037150 CTTTCAGGAAAGAGGAAAAGGGG + Intronic
1063569770 10:7204369-7204391 CTGTTAGGAAGAAGTAAAGTTGG + Intronic
1063595536 10:7431804-7431826 CTGTAAGGAAGGATGGGAAAAGG + Intergenic
1063600989 10:7481263-7481285 CTCTTAGAAAAGAGGAAATAGGG + Intergenic
1064161335 10:12949165-12949187 CTTTTACTAAGGAGGAAACAAGG - Intronic
1064232829 10:13544559-13544581 AAGTGAGGAAGGAGGAAAACAGG + Intergenic
1064385276 10:14885263-14885285 CAGGTATGAAGGAGGAAAATAGG - Intronic
1064566300 10:16642234-16642256 CAGGTAGGGAGGAGGAAAAGAGG + Intronic
1064785628 10:18891385-18891407 CTAATGGGAAGAAGGAAAAAGGG + Intergenic
1065062121 10:21913151-21913173 CTGTTAGTAATGAGAAAAGATGG + Intronic
1065186778 10:23175963-23175985 CTGTTTGCAAGGAGAATAAAGGG + Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067385219 10:45812578-45812600 CTATTAGGAATGATGAAAATGGG - Intergenic
1067449804 10:46375381-46375403 CTATTAGGAATGATGAAAATGGG + Intergenic
1067634502 10:47992149-47992171 CTATTAGGAATGATGAAAATGGG - Intergenic
1069007968 10:63339113-63339135 CTGTTAGGCAGGTGGTAAAGTGG - Intronic
1069087636 10:64160019-64160041 GTGATAGGAAGCAGGATAAAAGG + Intergenic
1069303793 10:66942634-66942656 AAGTGAGGAAGGAGAAAAAAGGG - Intronic
1069457351 10:68563150-68563172 CAGAGAGGAAGGGGGAAAAAAGG - Intronic
1069879068 10:71580478-71580500 CTTTTAGAAAGGATGACAAATGG + Intronic
1070640729 10:78167059-78167081 GTGTTCTGATGGAGGAAAAAGGG + Intergenic
1071610544 10:87027526-87027548 CTACTAGGAAGGATGAAAATGGG + Intergenic
1072093058 10:92148487-92148509 GTGTTAGGAAGGAAGAATACAGG - Intronic
1072222308 10:93336807-93336829 CAGGTAGGAGGGAGGAAGAAGGG + Intronic
1073069067 10:100781944-100781966 CTGTTAGGAAGGGTGTCAAAGGG + Intronic
1073244267 10:102078408-102078430 CTTGTAGGAAGGAAGAAAGAGGG + Intergenic
1073864003 10:107780897-107780919 CTCTTGGGAGGGAAGAAAAAAGG - Intergenic
1074192554 10:111150397-111150419 CAGGTAGGAAGGAGGAGAAGAGG + Intergenic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074908566 10:117886663-117886685 CTGTGTGGAAGAAGGAAAAAAGG - Intergenic
1074966146 10:118492369-118492391 TGGTCAGGATGGAGGAAAAAAGG + Intergenic
1075923314 10:126231345-126231367 ATCTTAGGAGGGAGGAAATAAGG + Intronic
1076572415 10:131441331-131441353 CTGGAAGGAAGGTGGAATAAAGG + Intergenic
1077242497 11:1517928-1517950 CTGTTATGTAGGTGGCAAAATGG - Intergenic
1077853718 11:6100568-6100590 CAGGGAGGAAGGAGAAAAAAAGG - Intergenic
1078042008 11:7874765-7874787 CTGTGGGGTAGGAGAAAAAAGGG + Intergenic
1078360135 11:10661603-10661625 CTTTGAGGATGGAGAAAAAAGGG - Intronic
1080313900 11:30926440-30926462 CTGTCAGAAAGGTGGAAAATGGG + Intronic
1080597372 11:33785610-33785632 CTAATAAGAAGGAAGAAAAAAGG + Intergenic
1080753270 11:35170349-35170371 CTGTCAGGAAGGCGAGAAAAAGG - Intronic
1080885320 11:36362679-36362701 ATGGAAGGAAGGAGGAAAAGTGG - Intronic
1081179834 11:39971553-39971575 GTGTTAGGAAAGGGGAAAGACGG - Intergenic
1081405961 11:42698143-42698165 CAGGAAGGAAGGAAGAAAAAAGG + Intergenic
1081557048 11:44173865-44173887 CTGTTAGAAAGAAGAAAAAAAGG - Intronic
1082029643 11:47594887-47594909 CGGTTAGGAAAGAGGGAGAAGGG + Intergenic
1082640165 11:55650017-55650039 CTGATAGGAAGGCAGAAATAAGG - Intergenic
1083413876 11:62512849-62512871 CTGTTAGGAAGAAGGAAGGAAGG + Intronic
1085616231 11:78001195-78001217 CTGTTAGGAAAGAGGAAGGGAGG + Intergenic
1085736041 11:79040112-79040134 GGGTTAGGAGGGAGAAAAAAGGG - Intronic
1086189444 11:84061046-84061068 CTGTTTGGAAGGAGGAAGTGGGG - Intronic
1086582485 11:88415076-88415098 CTGGTGGCAAGGAGAAAAAAGGG + Intergenic
1086947215 11:92854726-92854748 CTGTTCCAAAGGGGGAAAAAAGG - Intronic
1087209121 11:95428269-95428291 CTGTGAGGGAAGAAGAAAAATGG - Intergenic
1087221876 11:95555094-95555116 CTGTGAAGAAGGAAGTAAAATGG - Intergenic
1087268077 11:96082753-96082775 CTGGAAAGAAGGAGGTAAAAAGG + Intronic
1087612356 11:100449552-100449574 CTGTCAGAAAAGAGGAAAAGGGG + Intergenic
1087859207 11:103132879-103132901 CTGTTAGGGAGGAGGAGTAGAGG + Intronic
1088292341 11:108254093-108254115 CTGTTAGGAAGGAGAAATAGGGG + Intronic
1089193414 11:116672906-116672928 CAGTAAGGAAGAAGGAAAAGAGG + Intergenic
1089280501 11:117371040-117371062 ATGTTAGAAAGGAAGACAAAAGG - Intronic
1089298567 11:117484088-117484110 CCGGAAGGAAGGAGGAGAAAGGG - Intronic
1090271930 11:125392761-125392783 GTGTGAGAAAGAAGGAAAAAAGG + Intronic
1090532536 11:127606007-127606029 CAGTTACGACAGAGGAAAAAAGG + Intergenic
1091454728 12:598524-598546 CTGTGAGAAATGAGGAGAAAGGG + Intronic
1092268133 12:6999391-6999413 CTGTGAGAAAGAAAGAAAAAGGG + Intronic
1092445210 12:8549465-8549487 CTGTCAAGAAGAAGGAAAAATGG + Intergenic
1092445762 12:8555630-8555652 CTCTCAGGAAGGAGACAAAAGGG + Intergenic
1092746668 12:11678846-11678868 CTGTGAGGCAGGGGAAAAAAAGG + Intronic
1092911585 12:13149928-13149950 CTCTTAGGAAGGAGAAAAGTAGG - Intergenic
1093441348 12:19200546-19200568 CTACTAGGAATGAGGAAAAGAGG - Intronic
1093556992 12:20488156-20488178 CTGGGAGGAAGAAGGTAAAAAGG - Intronic
1094038585 12:26098207-26098229 CTTTTAAGATGGTGGAAAAACGG + Intergenic
1094045360 12:26160637-26160659 CTATGAGTAAGGAAGAAAAATGG - Intronic
1094073716 12:26449664-26449686 CAGGTAGAAAGGAGGAAGAAAGG + Intronic
1094145086 12:27220317-27220339 CTGTCAGGGAGGGGGAAATAAGG + Intergenic
1094612441 12:32007330-32007352 CTTTTAGGAAGAATGCAAAATGG + Intergenic
1094650506 12:32371396-32371418 CTGCCAAGAAGGAGTAAAAAGGG - Intronic
1094739110 12:33268422-33268444 TGGTTAGGAGGGAGGGAAAAAGG + Intergenic
1095311245 12:40699691-40699713 CTGTTACGAAGGATCAAATAAGG - Intronic
1095497769 12:42803317-42803339 CTGGTAAGAAGGAGGAAATCTGG + Intergenic
1095735887 12:45555771-45555793 CTGGAAGGCAGGAGGAAGAAAGG - Intergenic
1096558333 12:52418092-52418114 CTGTTGGGCAGGCAGAAAAATGG - Intergenic
1098593380 12:72241052-72241074 CTTTTAGGAAGAAGGAAGAGAGG - Intronic
1099186837 12:79524203-79524225 CTGGAAGGAAGGAGAAAAGATGG + Intergenic
1099281660 12:80656466-80656488 TTGTTTTCAAGGAGGAAAAATGG - Intronic
1099285549 12:80710460-80710482 CTGTTGGGGAGGAGGAGGAAAGG - Intergenic
1099336294 12:81364032-81364054 TTGTTAGAAAGGAGAAAACAGGG + Intronic
1099360169 12:81690936-81690958 CTTATAAGAAGGAGGCAAAAGGG - Intronic
1099404221 12:82240332-82240354 CTGTTAAAAAGTAGGCAAAAAGG - Intronic
1100928901 12:99584029-99584051 CTGTTGTGAAAAAGGAAAAAGGG - Intronic
1101067755 12:101040450-101040472 CTGTTAGCAAATAGGACAAATGG + Intronic
1101111263 12:101488516-101488538 CTAATAAGAAGGAAGAAAAAAGG - Intergenic
1101590297 12:106119542-106119564 CTGTAGGGAAGCTGGAAAAATGG + Intronic
1101660350 12:106759761-106759783 CAGTTAGGAAAGAGGGAGAAGGG - Intronic
1101755023 12:107614587-107614609 CTGCTAGGTAGAAGGAAGAAGGG + Intronic
1104368510 12:128199966-128199988 CAGAGAGGAAGGAGGAAAGAAGG - Intergenic
1104426316 12:128681313-128681335 CTCTCAGGAAGGAGGACAAGAGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1105436471 13:20382944-20382966 GTATTGGGAAGGAGGAAAAGTGG + Intergenic
1106203885 13:27570520-27570542 TTGTTAAGAAGGGGGACAAATGG + Intronic
1107305564 13:39014477-39014499 CTATATGGAAGGGGGAAAAAAGG + Intronic
1107535630 13:41327293-41327315 ATGGTAGCAAAGAGGAAAAAAGG + Intronic
1107858535 13:44638834-44638856 CTATTAGTAAGGAGGAAGAAGGG + Intergenic
1107967701 13:45612636-45612658 CAGGTAGGAGGGAGGAGAAAAGG - Intronic
1107992022 13:45827011-45827033 CTGTTAGCCATGAAGAAAAAAGG - Intronic
1108265725 13:48706750-48706772 CAGTAAGCAAGAAGGAAAAAGGG + Exonic
1108588634 13:51892806-51892828 CTGCTAGGACGGAGGAACAAAGG - Intergenic
1108820585 13:54345080-54345102 CTGTTACAGAGTAGGAAAAATGG + Intergenic
1109482710 13:62977355-62977377 GTGTTAAGAAGTAGGACAAAGGG + Intergenic
1110441986 13:75536540-75536562 CTTATAAGAGGGAGGAAAAAGGG + Intronic
1110599176 13:77351699-77351721 CTTTGAAGAAGAAGGAAAAAGGG + Intergenic
1111248890 13:85577322-85577344 CTGTAAGGAAGCAAGAGAAATGG + Intergenic
1111544080 13:89707224-89707246 CAGTTAGACAGGAGGAATAAAGG - Intergenic
1111567189 13:90031795-90031817 CTGTTAGTAAGAATGTAAAATGG + Intergenic
1111569839 13:90069645-90069667 AAGGAAGGAAGGAGGAAAAAAGG - Intergenic
1111569844 13:90069668-90069690 AAGGAAGGAAGGAGGAAAAAAGG - Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1111863868 13:93743696-93743718 CTGTTAGAAAGGAAAATAAAAGG - Intronic
1112540878 13:100311437-100311459 GTGTGAGGAAAGAGGAAGAAAGG - Intronic
1113322234 13:109245277-109245299 CAGTTAGGAAGAAGAAGAAAGGG - Intergenic
1113391315 13:109899994-109900016 AAGGTGGGAAGGAGGAAAAAGGG - Intergenic
1114411366 14:22503682-22503704 CTGGAGGGAAGGAAGAAAAATGG + Intergenic
1115259169 14:31435783-31435805 CTCTCAGGTAGGAGGAAAGATGG - Intronic
1116149015 14:41114096-41114118 CAGATAGGAAGAAGGAACAAAGG + Intergenic
1116172255 14:41417950-41417972 TTTATAGGAAGGAGAAAAAATGG - Intergenic
1116455009 14:45109946-45109968 CTGTAAGGAAGGACGAAGAGAGG - Intronic
1116974151 14:51096476-51096498 CTGTCTGGAAGGTGGAAAATTGG - Intergenic
1117116427 14:52517821-52517843 CTATTGGGAAGGAGAAAAACGGG - Intronic
1117118867 14:52547645-52547667 CTGTTTGGAGAGAGGAAGAATGG - Intronic
1117278402 14:54213049-54213071 CTGTCAGGAAGAAAGGAAAAAGG - Intergenic
1117533734 14:56684693-56684715 CTCTTAGGATGGAGGAAAAATGG - Intronic
1117658447 14:57980320-57980342 GTGTTAGGATGGAGGCAAATGGG + Intronic
1117836464 14:59811949-59811971 TAGTTAGGAAGGAGGAAAGGAGG + Intronic
1118337912 14:64870107-64870129 CTGTAAGAAAGGAGTGAAAAGGG + Intronic
1118454128 14:65929691-65929713 GTGGTGGGAAGGAGGCAAAAGGG + Intergenic
1118678564 14:68215341-68215363 CTGTTTGGAAGGTGGAGAAGAGG + Intronic
1119046847 14:71326042-71326064 GTGGGAGGAAAGAGGAAAAAAGG - Intronic
1119053769 14:71397242-71397264 ATGTCATGATGGAGGAAAAATGG - Intronic
1119597814 14:75952404-75952426 CTGTTGGGAGGGATGTAAAATGG + Intronic
1120486880 14:85125266-85125288 CTGTCAGGATGAAGAAAAAAAGG - Intergenic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1121898887 14:97674272-97674294 TTCTAAGGAAGAAGGAAAAAGGG + Intergenic
1124415881 15:29473010-29473032 CAGTTAGGAAGGGGGAAAGGAGG + Intronic
1125048155 15:35267460-35267482 CAGTAAGGAAGTAGGAATAAGGG - Intronic
1125421760 15:39511298-39511320 ATGGAAGGAAGGAGGAAAAGGGG + Intergenic
1125536627 15:40444428-40444450 CGGTGAGGTAGGAGGAAAACAGG - Intronic
1125916470 15:43492716-43492738 AGGTTAGGAAGGAGGGGAAAGGG - Intronic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1126463991 15:48943957-48943979 CTGTTAGTAAGGTAGAAAGAGGG + Intronic
1126464033 15:48944284-48944306 CTGTTAGTAAGGAAGAATGAGGG - Intronic
1127305453 15:57701207-57701229 CTGGGAGGAAGGATGACAAAGGG - Intronic
1127319244 15:57826606-57826628 CTGGTAGCAATGAGGAAAATAGG - Intergenic
1127785002 15:62348053-62348075 CTGTGAGGAGGCAGGAGAAAGGG + Intergenic
1128219683 15:65959455-65959477 CTGTTTTGATGGAGGAAAAGTGG - Intronic
1128530860 15:68446603-68446625 CTGTTGGGAAGGAAGAAAGAAGG + Intergenic
1128826301 15:70720469-70720491 CTGTTAAGAAAGGGGAAGAATGG - Intronic
1129691966 15:77718909-77718931 CTGCTAGAAATGAGGAAATAAGG - Intronic
1129916956 15:79282688-79282710 CTGCGAGGAAGGAGGAAGGAGGG - Intergenic
1129998420 15:80026568-80026590 CTGTTAGAAAGGAAACAAAAGGG - Intergenic
1130350615 15:83088444-83088466 TTGATAGGAAGGAAGAAGAAAGG - Intergenic
1131332789 15:91517363-91517385 CTGGTAGGAAGGACGAAACTAGG - Intergenic
1131334483 15:91534807-91534829 TTGCTAGTCAGGAGGAAAAAGGG - Intergenic
1131469347 15:92682996-92683018 CTGGCAGGAAGTAGGACAAAAGG + Intronic
1132022188 15:98372230-98372252 CGGTAAGGAAGGAGGATCAAAGG + Intergenic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1133629009 16:7601124-7601146 ATGTTAGGAAGGATGAAAATGGG + Intronic
1134360953 16:13530690-13530712 CTGTAAGGAAGGAAGAAAAAGGG - Intergenic
1135919888 16:26640374-26640396 CTGCAAGGAAGGAGGAATTATGG + Intergenic
1137440716 16:48496832-48496854 CTGTGAGGAAGGCGGAGAAGGGG - Intergenic
1137602883 16:49768576-49768598 CAGGGAGGAAGGAGGAAAACTGG - Intronic
1138074377 16:54026338-54026360 CAGGTAGGAAGAAGGAAGAAAGG + Intronic
1138174090 16:54880467-54880489 CTGGAAGCAGGGAGGAAAAAAGG - Intergenic
1138237540 16:55397632-55397654 CAGTTAGGGAGGAGGAAGAGTGG - Intronic
1139606940 16:68025695-68025717 CTGTGAGTGAGGGGGAAAAAAGG - Intronic
1140022270 16:71249659-71249681 CTGTTTGGAATGAGCAAAAACGG - Intergenic
1140446710 16:75035046-75035068 CTGTTAGTAAGAATGTAAAATGG - Intronic
1140828595 16:78730280-78730302 AGGCAAGGAAGGAGGAAAAAAGG - Intronic
1142219050 16:88844042-88844064 CTGTTTGGAAGCAGGTAGAAGGG + Intronic
1142244017 16:88960585-88960607 CAGGCAGGAAGGAGGAAGAAGGG - Intronic
1143354207 17:6313283-6313305 CTGAATGGAAGGAGGAAAAGTGG + Intergenic
1143472545 17:7185068-7185090 CAGTTTGGGAGGAGGAGAAAAGG + Intergenic
1143821123 17:9564243-9564265 CAGTTAGGCAGGAGAAAAAGAGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1145233574 17:21192638-21192660 CTGGTTGGTAGGAGGACAAATGG + Intronic
1145931583 17:28689829-28689851 CTGTTAGAAAGGAGGAAAGGGGG - Intronic
1145934171 17:28705383-28705405 GTGTCAGGCAGGAGAAAAAAAGG - Intronic
1145980657 17:29009438-29009460 CTGCTGGGAAGTAGGAGAAAGGG + Intronic
1147219907 17:38922466-38922488 TTGTGAGGAAGAAGGAAGAAAGG - Intergenic
1147597321 17:41725323-41725345 CTGGTGGGAGGGAGGAAGAATGG + Intronic
1147893122 17:43731536-43731558 ATTTTAGCAAGGAGGAAGAAGGG - Intergenic
1147930876 17:43980082-43980104 GTGTTAGAAATGAGGAAAAATGG - Intronic
1148041942 17:44714520-44714542 CTGTTAGTAAGGGGTAGAAATGG - Intronic
1149784216 17:59421796-59421818 CTGTTAACAGGGAGGATAAATGG + Intergenic
1149827773 17:59845206-59845228 CTGGAAGGAAAGAGGAGAAAAGG + Intergenic
1150201905 17:63365879-63365901 GTGTTAGAAAGGAGGTAAAAAGG - Intronic
1150253828 17:63727449-63727471 CTGTTAATTAAGAGGAAAAAAGG - Intronic
1151065708 17:71147452-71147474 CTTTTAAAAAGGAGGAAAAATGG - Intergenic
1152958948 18:65741-65763 GTGTTTGGAAGCAGTAAAAACGG + Intronic
1153347180 18:4039440-4039462 CTCTTAGGAAAGAGAAAAAGAGG - Intronic
1153574099 18:6503882-6503904 TTGAAAGGAAGGAAGAAAAAGGG + Intergenic
1153871563 18:9325337-9325359 CAGTTAGGTAGGAGGAATAAGGG + Intergenic
1154088096 18:11327065-11327087 CTTATAAGAAGGAGGCAAAAGGG + Intergenic
1155079313 18:22392046-22392068 TTTTTATGAAGGAGGAAACAAGG + Intergenic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155421179 18:25658286-25658308 CTATGAGGATTGAGGAAAAAGGG - Intergenic
1155792533 18:29992174-29992196 ATGTTAGGAAGTAAGAATAAAGG - Intergenic
1155865705 18:30962470-30962492 ATGTTAGGAAGGAGAAAGCAAGG - Intergenic
1156601930 18:38617870-38617892 CTGCTTGCAAGGAGAAAAAAAGG + Intergenic
1156837169 18:41568088-41568110 CAGTGAGGAAAGAGAAAAAATGG - Intergenic
1157636963 18:49168169-49168191 CTCTGAGGAAGGAGGAAAAAGGG + Intronic
1157648053 18:49298002-49298024 ATGCTAGGAAAGGGGAAAAAAGG + Intronic
1157729661 18:49992516-49992538 CTGTAAGTAAGGAAGAGAAAGGG - Intronic
1158348965 18:56545230-56545252 CTGTTAGCAAGAATGTAAAATGG + Intergenic
1158388106 18:57017954-57017976 CTGTTCTGAAGGAGCAAATATGG + Intronic
1158717349 18:59892465-59892487 CTATTAGGAAGCAAGAAAAATGG + Intergenic
1158998198 18:62945395-62945417 TGGTTAGGAAGGAGGAAGTAAGG - Intronic
1159989329 18:74883889-74883911 CTGTTATGTAGGAGGGAAACAGG + Intronic
1159991419 18:74913368-74913390 CTGTTAAAAAGGAGAAAAGAAGG + Intronic
1160621630 18:80175115-80175137 CTGTTAGGAAGAAGGATTATGGG - Intronic
1160692106 19:464937-464959 TTGATAGGTAGAAGGAAAAAAGG + Intronic
1160847938 19:1174539-1174561 TTCTGAGGAAGGAGGAAAAAAGG - Intergenic
1162124876 19:8494098-8494120 CTGATAGGAAAAAAGAAAAAAGG - Intronic
1162188158 19:8923062-8923084 CTGCAAGGAAGGAGAAAAGAAGG + Intronic
1164937093 19:32223431-32223453 CGGGAAGGAAGGAGAAAAAAAGG + Intergenic
1165481141 19:36064992-36065014 CTGGTAGGAAGCAGGGCAAAGGG + Intronic
1165832770 19:38737387-38737409 TTCTAAGGGAGGAGGAAAAAAGG + Exonic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1165998852 19:39865424-39865446 CTGGAAGGAAGGAGGGGAAAAGG + Intronic
1166540323 19:43600872-43600894 CAGTTAGGAAGGTGGAAAAAAGG - Exonic
1167040780 19:47021393-47021415 CTGGTGGGAAGGAGGAGGAAGGG - Intronic
1168057756 19:53872960-53872982 CTCTTGAGAAGGAGGAAAATAGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925248118 2:2402887-2402909 CTTATAGGAAGAAGGAGAAAAGG - Intergenic
927739474 2:25554924-25554946 CTCTGAGGAAGGAGGAAAATGGG + Intronic
929421120 2:41790638-41790660 CCTTTAGGAAAGAGGAAGAAGGG - Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929837706 2:45422288-45422310 CTGTTTGAAAGGAGGAGAAGGGG - Intronic
930430808 2:51273595-51273617 CGGATAGGAAGGAGGGGAAAGGG - Intergenic
930465209 2:51739212-51739234 CAGTGAGGAAAGAGCAAAAAAGG + Intergenic
930595521 2:53383033-53383055 CTGGGAGGAGAGAGGAAAAAGGG + Intergenic
930723477 2:54659913-54659935 CTGTTAGGGAAGAGGGGAAAAGG - Intronic
931292405 2:60885441-60885463 CTGTTACCAAGGGGGAAAAAAGG - Intronic
931356537 2:61541892-61541914 CTCTTGTGAAGGGGGAAAAAAGG + Intergenic
931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG + Intergenic
931847923 2:66223524-66223546 CTGGGAGGGAGGAGGAAAAAAGG + Intergenic
931919032 2:66992397-66992419 CTATTAGTAAGGAAGAAAAGAGG + Intergenic
931953597 2:67392925-67392947 ATGTCAGGAATAAGGAAAAATGG + Intergenic
932080064 2:68705933-68705955 CTATTAGGAAGGAAGAAAGGAGG + Intronic
933460979 2:82585079-82585101 CTGTCAGGAAGGAGGGCAATGGG - Intergenic
934112091 2:88753525-88753547 TAGGTAGAAAGGAGGAAAAAAGG - Intergenic
934769752 2:96900264-96900286 CTGTGAGGAAGGAAGAACAGAGG - Intronic
934984749 2:98876384-98876406 CTGTTAGGAAGCAGGCCACACGG + Intronic
935380058 2:102442462-102442484 ATGGAAGGAAGGAGGAAAGAAGG + Intronic
935503234 2:103868065-103868087 CTTAGAGGAAGGAGGAAAGAGGG + Intergenic
935756254 2:106278296-106278318 CTGTTGGGAAAAAGGAAAAGGGG - Intergenic
936113225 2:109682181-109682203 CTGTTGGGAAAAAGGAAAAGGGG + Intergenic
936851447 2:116903542-116903564 CAGTAAGTAAGGTGGAAAAAAGG - Intergenic
937001816 2:118474566-118474588 CTCTCATGAAGGAGGAAAACAGG - Intergenic
938557681 2:132440417-132440439 CCCCTAGGAAGGAGCAAAAAGGG - Intronic
938559496 2:132459077-132459099 GTTTTAGGAAGGAGTGAAAAAGG - Intronic
938926516 2:136048100-136048122 CTGTTAGCAAGAAGGGAGAATGG + Intergenic
939573517 2:143868029-143868051 CTTTTAGAAAAGAGGAAAAGAGG + Intergenic
940117776 2:150228118-150228140 ATGTTAGGATTGAGGAAATATGG - Intergenic
940684270 2:156826764-156826786 ATGTGCGGAAGAAGGAAAAAGGG - Intergenic
942011093 2:171762926-171762948 GTGTTAGGAAGAAGGGAAAAGGG + Intergenic
942186092 2:173426420-173426442 CTGGAAGGAAGAAGGATAAAAGG + Intergenic
942803053 2:179898231-179898253 CTGTTTGGAAAGAGTGAAAATGG - Intergenic
942849816 2:180471370-180471392 CTGTTAGAAAGATGGAAAAGGGG - Intergenic
943206055 2:184897421-184897443 CTGTATGGAAAGGGGAAAAAAGG - Intronic
943445875 2:187987348-187987370 CTGTTAAGGAGGAGAAAAGAGGG + Intergenic
943460880 2:188170502-188170524 CTGATATGAAGGAGAAAAACTGG + Intergenic
943836705 2:192524120-192524142 GTATTAGAAAAGAGGAAAAATGG + Intergenic
944079624 2:195772079-195772101 TTGTTAGAGAGGAGGAATAAGGG + Intronic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
944473377 2:200079509-200079531 CAGGTAGGAAGGAAGAAGAAAGG - Intergenic
945573117 2:211496081-211496103 CTGAAAGGTAGGAGGAAAACTGG - Intronic
945690300 2:213025840-213025862 CTATTTGGAAGTAGGAAAAGAGG - Intronic
946491857 2:220156341-220156363 TTGTTGGGTTGGAGGAAAAAAGG - Intergenic
948228271 2:236330040-236330062 ATTTTAGAAAGGAGAAAAAATGG + Intronic
948297121 2:236869081-236869103 CAGTTTGGAAGGAGGGGAAAGGG - Intergenic
1168753075 20:297568-297590 ATGCTGGGAAGGAGGTAAAATGG + Exonic
1169260423 20:4134446-4134468 CCGTGAGGCAGGAGGAAAACCGG + Intronic
1169409756 20:5357868-5357890 TGGTGAGGAAGGAGGGAAAATGG + Intergenic
1171062554 20:21980511-21980533 GTATTAGGAAGGAGGAAGGAAGG - Intergenic
1172245387 20:33442479-33442501 CTGTTAGCGGAGAGGAAAAATGG - Intronic
1172924057 20:38514291-38514313 CTCAAAGGCAGGAGGAAAAAGGG - Intronic
1173546001 20:43898432-43898454 CTGGGAGGTAGGAGGAAAACAGG + Intergenic
1173801956 20:45899588-45899610 GTGTGAGGATGGAGGAAGAAAGG - Intronic
1174193601 20:48757469-48757491 TTTTTAGGAAAGAGGAAAACAGG + Intronic
1174413015 20:50348271-50348293 CTGTTAGGAAGGAGGAAGTGGGG - Intergenic
1174767199 20:53265424-53265446 GAGTTAGGAAGGAGGAAAGGAGG + Intronic
1174863410 20:54113702-54113724 CTCTTAGAAAGGAGTAAAGAAGG - Intergenic
1175163644 20:57027631-57027653 CAGTGAGGAAGAAGGAAGAATGG + Intergenic
1175355457 20:58363007-58363029 CTGTTCTCAAGGAGGAAAATTGG + Exonic
1176904616 21:14484386-14484408 CCTTTAGGATGGAGGAAAGAGGG + Intergenic
1177020857 21:15855796-15855818 GTGATGGGAAGGCGGAAAAAAGG - Intronic
1177733173 21:25055456-25055478 CTGTTAGGAAAGATGACAATTGG - Intergenic
1178260901 21:31098810-31098832 CTGTGAGGGAGGTGGAAATAAGG + Intergenic
1178267033 21:31152994-31153016 TTGTTGGTAAAGAGGAAAAATGG - Intronic
1178957196 21:37033654-37033676 CTGTTAGGCAGGAGAAATAAGGG - Intergenic
1179340152 21:40500121-40500143 CTGGGAGGGAGGAGGAGAAAAGG + Intronic
1179804702 21:43829845-43829867 CTGTCACGGAGGAGGAAAAGTGG - Intergenic
1180820427 22:18823420-18823442 CTGGTAGCAAGGAGGCACAAGGG + Intergenic
1181206651 22:21257892-21257914 CTGGTAGCAAGGAGGCACAAGGG + Intergenic
1181956034 22:26588921-26588943 CTGTTGGGAAGTGAGAAAAAGGG + Intronic
1182078979 22:27515581-27515603 CTGTTTGGAAAGAGCAGAAAAGG - Intergenic
1182147843 22:28007884-28007906 CTGATTAGGAGGAGGAAAAATGG - Intronic
1182299424 22:29329449-29329471 CAGTTAGGAAGTGGGAACAATGG + Intronic
1182803672 22:33052461-33052483 CTGTTTGGGAGGAGGAAAGGAGG + Intronic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1183348055 22:37318814-37318836 CTGTCAGGAAGAAGCCAAAAGGG - Intergenic
1184612349 22:45612862-45612884 CTCTGGGGAAGGAGGAAAACAGG + Intergenic
1203220273 22_KI270731v1_random:37531-37553 CTGGTAGCAAGGAGGCACAAGGG - Intergenic
949117751 3:348580-348602 ACCTTAGTAAGGAGGAAAAAAGG - Intronic
949186191 3:1194815-1194837 CTGCCAGGTAGCAGGAAAAAAGG - Intronic
950313085 3:11975910-11975932 CTGAAAGGAAGGATCAAAAAAGG + Intergenic
950375071 3:12564589-12564611 CTGTTAAAAAAGAGAAAAAAGGG - Intronic
950982979 3:17328974-17328996 CACTGAGGAAAGAGGAAAAAAGG + Intronic
951338049 3:21448411-21448433 CTGCAAAGAAGGAAGAAAAATGG + Intronic
951844065 3:27066436-27066458 CTGTTAGCAAAGAAGAAAGAAGG + Intergenic
951928587 3:27937986-27938008 GTATAGGGAAGGAGGAAAAATGG + Intergenic
951981438 3:28571409-28571431 ATGTTACCAAGAAGGAAAAATGG + Intergenic
951982381 3:28579817-28579839 GTGTGAGGAAGGAAGTAAAAGGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952220749 3:31321736-31321758 ATGTTGAGAAAGAGGAAAAAAGG - Intergenic
952639368 3:35573901-35573923 TTTTTATAAAGGAGGAAAAAGGG + Intergenic
953016332 3:39080251-39080273 ATGTTTGGAGGGAGGAAGAATGG + Intronic
953228369 3:41041878-41041900 CTGTTGGAAAGGAGGAGGAAGGG + Intergenic
953249052 3:41226563-41226585 CTAATAGTAAGGAGGAAGAAAGG + Intronic
954423289 3:50430110-50430132 GTTTGAGGAAGGAGGCAAAAGGG + Intronic
955278309 3:57569258-57569280 CTGTTTGGAAAAAGAAAAAAAGG + Intergenic
955521419 3:59779023-59779045 CTGTTAGAAAGGAAGAGAATGGG + Intronic
956793042 3:72694723-72694745 CTTTTAGGAATGAGTAAAACAGG - Intergenic
956985886 3:74700082-74700104 TTGCTTTGAAGGAGGAAAAATGG - Intergenic
957571272 3:81949999-81950021 CTTTGAGGAAGGAGAGAAAAAGG - Intergenic
958253964 3:91303046-91303068 TTGTTAGGAGGGAGGAATAGCGG + Intergenic
958912196 3:100006388-100006410 TTATGGGGAAGGAGGAAAAAAGG - Intronic
960631743 3:119739248-119739270 CTTTTAGGAAGAAGAAGAAATGG + Exonic
961758675 3:129148384-129148406 CTGCTAGTGAGGAGGCAAAATGG - Intronic
962269495 3:133967729-133967751 GTGCAAGGAAGGAGGAGAAAGGG - Intronic
962850687 3:139306449-139306471 CTGAAAGGAAGGATGAAAAATGG + Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
962910941 3:139848972-139848994 ATGTTAGGGAGGCTGAAAAAAGG + Intergenic
963092004 3:141490965-141490987 CTCTTAGGAAGGAGTAAAGTAGG + Intronic
963105327 3:141642212-141642234 CTGTTAGGCTGAAGGCAAAATGG + Intergenic
963723677 3:148894070-148894092 CAGAGAGGAAGGAAGAAAAATGG + Intronic
963791825 3:149590816-149590838 CCATTAGGAAGGAAGGAAAAGGG + Intronic
963998031 3:151734008-151734030 CTGTGAAGAAGCTGGAAAAAGGG + Exonic
964145352 3:153454864-153454886 CTGTTAGGAAGTAGAATAATAGG - Intergenic
964345669 3:155752188-155752210 CTCTTAGGAAGGAGGAAAAGGGG - Intergenic
964894149 3:161574639-161574661 CTTTCAAGAAGGAGGAGAAAGGG - Intergenic
965656006 3:170985657-170985679 ATATTAGGAAGGAGGCAGAAAGG - Intergenic
965828187 3:172751392-172751414 CTGTTAGTAAGGGGTAAAAGAGG - Intronic
966155798 3:176915055-176915077 CAGACAGGAAGGAGGAAAATTGG + Intergenic
966575215 3:181493396-181493418 CTTGAAGGAAGGAGGAAGAAAGG + Intergenic
966931256 3:184677305-184677327 CTGTAGTGAAGAAGGAAAAATGG + Intronic
967219583 3:187237406-187237428 CTGTTAGGACAGAGAAGAAAAGG - Intronic
967563255 3:190942772-190942794 GAGATAGGAAGGAGGAAAAAGGG - Intergenic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
970603497 4:17658751-17658773 ATGCCAGGAAGGAGGAAAAGAGG + Intronic
971968499 4:33592961-33592983 GTGTTGGGAAGTAGGAACAAAGG + Intergenic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
973087792 4:46089660-46089682 TTGTTAAGAAGTAGGAAAATAGG + Intronic
973771025 4:54206780-54206802 CTTATAGGAAGCTGGAAAAATGG - Intronic
973811780 4:54577863-54577885 CTTTTAGGAAGGAGAAAGAGAGG - Intergenic
974103282 4:57440595-57440617 CTGTTAGGAAAAAATAAAAAAGG - Intergenic
975035407 4:69674300-69674322 CTGTTAGGAAGAGAAAAAAATGG + Intergenic
975404837 4:73977141-73977163 CTGAGAGGAAGGAGGAGAAGAGG - Intergenic
975439316 4:74392813-74392835 AGTTTAGGAAGGAGGAAAAATGG + Intergenic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
975862499 4:78692327-78692349 CCATTAGGAAGAAGGAAAGACGG + Intergenic
976847803 4:89510312-89510334 TTGTGAGGAAGGAGAAGAAATGG + Intergenic
977178434 4:93842767-93842789 CTGTTAGAAGGGAGGTAACAGGG + Intergenic
977180066 4:93863199-93863221 CTGGTAAGAATGTGGAAAAAAGG + Intergenic
979098262 4:116578367-116578389 CTTTTATGAAGGAGGAGAATTGG + Intergenic
979160989 4:117461019-117461041 CTGTTAGGAACCATGAAAAGTGG + Intergenic
979582821 4:122379825-122379847 CTGCTACAAAGGAGGAAAGAAGG - Intronic
979626757 4:122853537-122853559 GAATTAGGAAGGAGGGAAAAGGG + Intronic
979639362 4:122995571-122995593 CTTTTATAAAGGAGGAAAAATGG + Intronic
979669643 4:123348599-123348621 CTATTGGGAAGGAAGAAAGAAGG + Intergenic
980003063 4:127512790-127512812 CTGATATGAAGGAGAAAAACTGG + Intergenic
980296777 4:130929323-130929345 GTGGAAGGAAGGAGGAGAAAGGG + Intergenic
981467383 4:145088884-145088906 CAGTGAGTAAGGAGGAGAAATGG - Intronic
982806464 4:159771487-159771509 ATGTTAGAAAGAAGAAAAAAAGG - Intergenic
983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG + Intergenic
984249437 4:177314263-177314285 TTCTTACAAAGGAGGAAAAAGGG + Intronic
984521724 4:180810138-180810160 CTGTTTGGAAGGATGAAAAAGGG + Intergenic
985904515 5:2823087-2823109 CTCTGAGGAAGAAGGAAAACGGG + Intergenic
986597217 5:9436507-9436529 CTATGAGGAAGGAGGCTAAATGG - Intronic
986850349 5:11804695-11804717 GGGTTTGGAAGGAGGAGAAAAGG + Intronic
986866236 5:11992077-11992099 CTGTTAAGAAGAAAGAGAAAAGG + Intergenic
987264175 5:16235195-16235217 CTGAAAGCAAGGAGGAGAAAGGG - Intergenic
988054911 5:26082191-26082213 CTTTTAGGAAGGAAGAAAACTGG + Intergenic
988434750 5:31160917-31160939 CTATTAGGAAGGAGTAAACTGGG - Intergenic
989144805 5:38238205-38238227 CTCTGAGGAAGAAGGAAAAAGGG + Intergenic
990493060 5:56320852-56320874 CTGTTAGAAAGTAGGAGAAACGG + Intergenic
990561747 5:56990506-56990528 GTGAGAGGAAGGAGGAAAGAAGG - Intergenic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
990969263 5:61485083-61485105 CTGCGAGGAAGGGGGAAAAGAGG - Intronic
991052359 5:62287023-62287045 CTCAAAGGAAGGAGAAAAAATGG - Intergenic
991126765 5:63078450-63078472 CTTTTAAGAAGCAGGATAAAAGG + Intergenic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
991674371 5:69076437-69076459 CCTTTATGAAGGAGGAAAAAAGG + Intergenic
992499761 5:77330492-77330514 CTGTTAGGAAGGCCACAAAAAGG - Intronic
992686258 5:79202339-79202361 CTGTTTTGAAGGAAGAACAATGG - Intronic
992988710 5:82260766-82260788 ATGTTATGAAGCAGTAAAAAAGG + Intronic
993342925 5:86747020-86747042 CTGTTAGTAGGCAAGAAAAAGGG - Intergenic
993372083 5:87105408-87105430 CTCTTAGGTTGGAGGAACAAAGG + Intergenic
993531431 5:89029384-89029406 CTGTGAGGAATGGGGGAAAAGGG + Intergenic
993605425 5:89985013-89985035 CTATGAGGAAGGAGGAATATGGG - Intergenic
994259251 5:97637511-97637533 ATGTTATGGAGGAGGAAACAGGG + Intergenic
994466526 5:100140137-100140159 CTGAGAGCAAAGAGGAAAAAAGG + Intergenic
994750051 5:103726455-103726477 TTGTTAGGAAGCAGGTAAGATGG - Intergenic
994776654 5:104042938-104042960 ATGTTAAGAAGGAGGAGAATAGG - Intergenic
994982763 5:106898261-106898283 GTGTTAGAAAGGAGTAAGAATGG - Intergenic
995222406 5:109664842-109664864 TGGTTAGGAAGAAGGAAAAGAGG + Intergenic
995238354 5:109856972-109856994 GTGTTATGAAGGAGTAAAAAGGG + Intronic
995495930 5:112743217-112743239 CTTTTAAGAAGGAGGCAGAAGGG - Intronic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
995765193 5:115607080-115607102 CTGATAGGTAGAAGAAAAAAAGG + Intronic
995845017 5:116484323-116484345 ATGTAAGGAAGGAGGAAGAAAGG - Intronic
996838875 5:127824241-127824263 CTGTTAGAAAGGAAAGAAAAAGG + Intergenic
996864623 5:128106050-128106072 CTGGTAGGACAGAGAAAAAAAGG - Intronic
997768330 5:136527282-136527304 CTATTGAAAAGGAGGAAAAAGGG - Intergenic
998847269 5:146323263-146323285 CTGGTAGAGAGGAGGAACAAGGG - Intronic
998913187 5:146983782-146983804 TTATGAGGAAGGAAGAAAAAAGG - Intronic
999549941 5:152675734-152675756 CAGTTAGAAAGGAGGAAGTATGG - Intergenic
999574264 5:152957264-152957286 CTGTAATGGAGGAGAAAAAAAGG + Intergenic
999658294 5:153832081-153832103 CTTTTAGGAAGAAGAGAAAATGG - Intergenic
1000279530 5:159770224-159770246 CTATTATGGAGGAGGAGAAAAGG + Intergenic
1000292843 5:159887133-159887155 TTGTTAGGAGGGAAGAAACATGG - Intergenic
1000465596 5:161572092-161572114 AATTTAGGAAGGAGGAAATAGGG + Intronic
1000602152 5:163287791-163287813 TTAAAAGGAAGGAGGAAAAAAGG + Intergenic
1001353932 5:171002300-171002322 CTGATGAGAAGGAGGAAAACTGG + Intronic
1001720779 5:173855361-173855383 CTGTTGGCCAGGAGGGAAAAAGG - Intergenic
1001997066 5:176170681-176170703 CTGGCAGGAAGGAAGAAAAGGGG + Intergenic
1002653038 5:180717777-180717799 CTGGTAGAAAAGAGGAAAGAGGG - Intergenic
1003246518 6:4386665-4386687 CGGTGAGGAAAGAGGAAGAAGGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004630824 6:17419647-17419669 CTGTTTGGAAGCAGGAAGCATGG + Intronic
1005077848 6:21926084-21926106 TTCTTTGGAAGGAGGAAAACAGG - Intergenic
1005466943 6:26124720-26124742 CTTGTAGGTAGAAGGAAAAAAGG + Exonic
1005528174 6:26673198-26673220 CTGCAAAGAAGGAGGAAAAAAGG - Intergenic
1005529341 6:26687096-26687118 CTGCAAAGAAGGAGGAGAAAAGG - Intergenic
1005530936 6:26705213-26705235 CTGCAAAGAAGGAGGAGAAAGGG - Intergenic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005539860 6:26796423-26796445 CTGCAAAGAAGGAGGAGAAAGGG + Intergenic
1005541455 6:26814550-26814572 CTGCAAAGAAGGAGGAGAAAAGG + Intergenic
1005542621 6:26828441-26828463 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1006180314 6:32150269-32150291 CTGGTAGGATAGAGGAACAAGGG - Intronic
1006876629 6:37303197-37303219 CTGTCACCAAGGAGGAAGAAGGG + Intronic
1007106600 6:39287504-39287526 CAGAAAGGAAGAAGGAAAAAGGG - Intergenic
1007180718 6:39927392-39927414 CTGTGAGGAAGGCGGAGAAGGGG + Exonic
1007307641 6:40919291-40919313 ATGAAAGGAAGGAAGAAAAACGG + Intergenic
1007610586 6:43146393-43146415 CAGTTAGAAAGGAGGAGAATTGG - Intronic
1007660775 6:43484640-43484662 TTGTGAGGAAGCAGTAAAAAAGG + Intronic
1007694345 6:43722708-43722730 CTGTTAACAATGAGGAATAATGG + Intergenic
1008151695 6:47960277-47960299 CTGATAGAAAAGATGAAAAAGGG + Intronic
1008189134 6:48432860-48432882 CTGTTTAGAAAGAGGAAAAATGG - Intergenic
1008338294 6:50333385-50333407 CTATGAGGAGGAAGGAAAAAAGG + Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009010677 6:57838564-57838586 CTGCAAAGAAGGAGGAGAAAGGG + Intergenic
1009012261 6:57856612-57856634 CTGCAAAGAAGGAGGAGAAAAGG + Intergenic
1009013436 6:57870558-57870580 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1009817360 6:68753306-68753328 CTTTAAGGAAAGTGGAAAAAGGG + Intronic
1009923653 6:70094332-70094354 ATGTTAGGAAAGAGGAGACAGGG - Intronic
1010390860 6:75335529-75335551 CTCTCAGGGAGAAGGAAAAAAGG - Intronic
1010663969 6:78604572-78604594 CTGGAAGGAAGGAGAAAAAAAGG + Intergenic
1010704305 6:79089669-79089691 GAGGGAGGAAGGAGGAAAAAAGG - Intergenic
1011011842 6:82711921-82711943 CTGTTAGGAAGGAAGAAGGAGGG - Intergenic
1011234154 6:85197236-85197258 CTGCTAGGAAGGAAGAAAGTTGG + Intergenic
1013004567 6:106060224-106060246 CAGTGAGGAAGGAGGAAAACAGG + Intergenic
1013209370 6:107973084-107973106 CTAATACTAAGGAGGAAAAAAGG + Intergenic
1013577573 6:111500000-111500022 CTGTTAGGGAGTTGGAAATATGG + Intergenic
1013642355 6:112098158-112098180 CTGTTACGAAGGAGAAATAAAGG + Intronic
1013818156 6:114123552-114123574 ATGTTAGGAAAGACAAAAAATGG - Intronic
1014032005 6:116716771-116716793 CTGTTAGGAAGGTAGAAAGGGGG + Intronic
1014209105 6:118689457-118689479 CTGTTAGGAATGAGAAGAGATGG + Intronic
1014248395 6:119092007-119092029 CTCTTAGCAATGAGGAAAAGAGG - Intronic
1014309896 6:119786946-119786968 GTTTCAGGAAGGAAGAAAAAGGG + Intergenic
1014997321 6:128165332-128165354 CTGTATGTAAAGAGGAAAAAGGG - Intronic
1015386830 6:132634242-132634264 TTGTTAGGAAGGAGGATACTGGG + Intergenic
1015972639 6:138758175-138758197 CTGACAGGAAGAAGGAAAATAGG + Intronic
1016848252 6:148590657-148590679 CTGGTGGGGAGGAGGAAATAAGG + Intergenic
1016863006 6:148740292-148740314 TTGTTAGGAAGGAAGGAAAAAGG + Intergenic
1017095322 6:150799742-150799764 CTGTGAGGAAGGAAGTTAAATGG - Intronic
1017309496 6:152959162-152959184 CCATTAGAAAGGAGGAAATATGG + Intergenic
1017315484 6:153026516-153026538 CTGTGAGGAATGAAGAAAGAGGG - Exonic
1017920138 6:158864695-158864717 CTGTACAGAAGGAAGAAAAAGGG - Intergenic
1017955500 6:159174347-159174369 CTTTTAGGAGGGAGGAAAACGGG - Intronic
1018395417 6:163374612-163374634 CTGCTGGGAAGGAGGAACACAGG - Intergenic
1019224288 6:170497524-170497546 CTGTTAAAAAGGAGGGATAATGG - Intergenic
1019718069 7:2550714-2550736 CTGGGAGGGAGGAGGAAACAGGG + Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020055382 7:5114324-5114346 CTGTTAGGAAAGAGAAAACAGGG + Intergenic
1020816593 7:12913060-12913082 CTGAAAGGAAGGGGGAAAATTGG + Intergenic
1021629338 7:22629116-22629138 CTTCTAAGAAGGAGGTAAAAGGG + Intronic
1021761523 7:23906618-23906640 CTGTTAGGAAAAAGGAAAGGTGG + Intergenic
1021973006 7:25983799-25983821 CTGGAAGGAAGGAAGAAGAAAGG - Intergenic
1022065284 7:26849107-26849129 ATGTTAGGAAGGGTTAAAAAAGG + Intronic
1022193909 7:28045055-28045077 CAGGCAGGAAGGAAGAAAAAAGG + Intronic
1022272694 7:28825637-28825659 CTTATTGGAAGGAGAAAAAAAGG + Exonic
1022391714 7:29949677-29949699 CTGTCTGAAAGAAGGAAAAAAGG - Intronic
1022520951 7:31006600-31006622 CTCTGAGGCAGGAGGGAAAAGGG - Intergenic
1022558094 7:31320409-31320431 CTGTTAGGGACTAGCAAAAAAGG - Intergenic
1022825207 7:34003996-34004018 CTGGAAGGAAACAGGAAAAAGGG - Intronic
1022832039 7:34077295-34077317 GAGTTAGGAAGGTGGGAAAAGGG + Intronic
1022881273 7:34590196-34590218 TACTTGGGAAGGAGGAAAAAGGG - Intergenic
1023238217 7:38113661-38113683 CTGTTAGACCAGAGGAAAAAAGG - Intergenic
1023396696 7:39758253-39758275 TGGTGAGGAAAGAGGAAAAAGGG + Intergenic
1023468864 7:40491229-40491251 CTTTTTGGAAGGAGGAATATTGG + Intronic
1023612552 7:41985915-41985937 CTGTTAGGAAGGAAGATTGATGG - Intronic
1023675281 7:42622282-42622304 CTGTAAAGCAGGAGGAAATATGG + Intergenic
1024213823 7:47229486-47229508 CTGTTAGCATGGGGAAAAAAAGG + Intergenic
1025072375 7:55911704-55911726 CTTTTAGGGAGGAAAAAAAAAGG + Intronic
1025488101 7:61077198-61077220 GTGGGAGGAAGGAAGAAAAAAGG - Intergenic
1026002052 7:66568016-66568038 CTGTGAAGAAGAAGGAAATATGG + Intergenic
1026345873 7:69473708-69473730 CTGTTTGTAAGGAGGAAGAGAGG + Intergenic
1026381259 7:69801855-69801877 GTGCTAGGAAGGAGGAAAGGGGG + Intronic
1027357966 7:77378179-77378201 TTGTTTGGAAGGCGGAAAATGGG + Intronic
1027557058 7:79678096-79678118 ATGTAAGTGAGGAGGAAAAACGG - Intergenic
1027826544 7:83123789-83123811 CTGTTAAGAAATAGGCAAAAGGG + Intronic
1027835493 7:83236197-83236219 ATGGTAGAAAGGAGCAAAAAGGG + Intergenic
1027961657 7:84953780-84953802 ATATTAGGAAGGAAGACAAAAGG - Intergenic
1028315209 7:89393172-89393194 CTTTTAGGAAGGAGTAAAAATGG - Intergenic
1028589527 7:92480690-92480712 CTGATGGGAAGGAGAAAAACTGG + Intergenic
1029930907 7:104370113-104370135 CTCTAAGGATGGAGGAACAAAGG + Intronic
1030244397 7:107366024-107366046 GTGGCAGGAAGGAGGAAGAAAGG + Intronic
1030408898 7:109149243-109149265 CTGGTGAGAATGAGGAAAAAGGG - Intergenic
1030587985 7:111445345-111445367 TTGCTAGGAAGGAGTAAAGATGG - Intronic
1031278299 7:119760759-119760781 ATGTTAGGAAGGATATAAAAAGG - Intergenic
1031538206 7:122960801-122960823 CTGTTAGGAGTAAGGAAAAGAGG + Intergenic
1031546532 7:123057071-123057093 CTGGAAGGAAGGAAGAGAAAAGG + Intergenic
1031867316 7:127051901-127051923 CCCTTAGGAAAGAGGAAGAAGGG + Intronic
1031936597 7:127741607-127741629 GAGTGAGGAAGGAGGAGAAAGGG - Intronic
1032169333 7:129571440-129571462 TTTTTAGCCAGGAGGAAAAATGG - Intergenic
1032355819 7:131209630-131209652 GTGTTAGCAAGGAGGAAGAAAGG - Intronic
1033533215 7:142287072-142287094 CTGTTAAGAAGGTGGACATAGGG - Intergenic
1033642939 7:143279801-143279823 GTGTAAGGAAGGTGGATAAATGG - Intergenic
1035913628 8:3595983-3596005 TTGTCAGGAAGGAGGCAAAGGGG - Intronic
1036609043 8:10334072-10334094 CTGCAAGCAGGGAGGAAAAAAGG + Intronic
1036624008 8:10450520-10450542 CTGGTAGGATGGAGGTAAAGTGG + Intergenic
1036718819 8:11153295-11153317 CTGTTAGAAGTGAGGAAATATGG + Intronic
1037039636 8:14215449-14215471 CTTCTAGGAAGTAGGAAAGAAGG + Intronic
1037533414 8:19802136-19802158 CAGTCAGTAAGGAGAAAAAATGG + Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038254140 8:25935135-25935157 CTGTTAGGAAGAATGAAGGATGG - Intronic
1039016851 8:33159115-33159137 AAGTAAGGATGGAGGAAAAAAGG - Intergenic
1039410669 8:37352600-37352622 CTGTCAAGAAGGAGGAAAAATGG + Intergenic
1039625224 8:39043372-39043394 CTGTTGGGAAGAATGCAAAATGG - Intronic
1039809976 8:41038183-41038205 CTGTTAGGAAAAAAAAAAAAAGG - Intergenic
1040122827 8:43701441-43701463 CTTTTAAAAAGGAGGAGAAATGG - Intergenic
1040312286 8:46243008-46243030 CAGGCAGGAAGGGGGAAAAAGGG + Intergenic
1040624527 8:49131816-49131838 CTGTGAGGAATGAGGACAAGGGG - Intergenic
1040856142 8:51949958-51949980 CTGTTGGCAAGAAGGTAAAATGG + Intergenic
1040932596 8:52750487-52750509 CTGCTAGGAACAGGGAAAAATGG + Intergenic
1040987993 8:53317370-53317392 CTCTTAGGAAAGAGAAAAAAGGG + Intergenic
1041442895 8:57917435-57917457 CTGTTGAGAAGGAGGTAAAGTGG - Intergenic
1043333596 8:79146889-79146911 TTTATAGGAAGGAGGAAATAAGG - Intergenic
1043334928 8:79163672-79163694 CAGTTAGGAATGAGGAGAAAAGG - Intergenic
1043735190 8:83731827-83731849 CTGTAATGAAGGAAGAAACATGG - Intergenic
1043977089 8:86595685-86595707 TTTTTAGGAAAGAGGAAAAAAGG + Intronic
1044533671 8:93336331-93336353 ATATTTGGAAAGAGGAAAAAAGG + Intergenic
1044638613 8:94354610-94354632 CTGTTAGTAAGAATGTAAAATGG + Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044771589 8:95641281-95641303 CTATGAGGAAGGAAAAAAAAGGG - Intergenic
1045651490 8:104345731-104345753 TTTTTAGGAAGGAAGCAAAATGG + Intronic
1046314959 8:112487663-112487685 TAGTTAGGAAAGAGGAAAAGAGG + Intronic
1046806197 8:118481438-118481460 CTGGTAGGAAGAAGGAAAAGAGG + Intronic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1048090952 8:131239672-131239694 GTCTTAAGGAGGAGGAAAAAGGG - Intergenic
1048120771 8:131579090-131579112 CTGTTAAGAAGGAGGATGGAAGG + Intergenic
1048553714 8:135456542-135456564 CTGTTTGAAGGCAGGAAAAATGG + Intergenic
1048827392 8:138441926-138441948 TTGGAAGGAAGGAGGAAATAAGG + Intronic
1049855595 8:144859804-144859826 CTGTTAGGAAGAAGAAAATTAGG + Intergenic
1050229239 9:3501203-3501225 CTTTTAGGAAGGTGGGTAAATGG - Intronic
1050651209 9:7778837-7778859 TTCCCAGGAAGGAGGAAAAATGG - Intergenic
1051077973 9:13262653-13262675 AGGTTAGGAATGAGAAAAAAAGG + Intronic
1051769960 9:20566784-20566806 AGATTAAGAAGGAGGAAAAAGGG + Intronic
1052046179 9:23796902-23796924 CTATTTGGAATGAGGAAAATGGG - Intronic
1052192133 9:25673344-25673366 CTGATACGAAGGAGGAAAACTGG - Intergenic
1052196930 9:25728444-25728466 CTGTTAGGAGGGGGGATAAGTGG - Intergenic
1052316935 9:27125003-27125025 CAGTTATGAGAGAGGAAAAAGGG - Intronic
1052340846 9:27362849-27362871 CTGTAAGGCAGAAGGGAAAAGGG - Intronic
1053130876 9:35614963-35614985 CTGATGGGAAGGGAGAAAAAGGG + Intronic
1054730779 9:68700974-68700996 CTGAGAGGAAAGAGGAACAAGGG + Intergenic
1055006096 9:71508735-71508757 CAGTTTGGAAGAAAGAAAAAGGG - Intergenic
1056450960 9:86716332-86716354 CCTTTAGGAAGGAGGAACCACGG + Intergenic
1056774999 9:89505371-89505393 ATGTTATGGAGGAGGAAACAGGG + Intergenic
1058301605 9:103380349-103380371 CAGTTAGAAAGAAGGAATAAGGG - Intergenic
1058627737 9:106952841-106952863 TGTTTAGGAAGGAGGAAAATAGG + Intronic
1058635341 9:107032957-107032979 AGGTTAGGAAGGAAGCAAAATGG + Intergenic
1059163797 9:112060119-112060141 CTCTTAGGAAGCAGGAGATAGGG - Intronic
1059571763 9:115445329-115445351 CTGTCAGGAGGGAGGAAGGATGG - Intergenic
1060138709 9:121184501-121184523 CTGTTTGGAAGGGGGAAAAAGGG - Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1060788934 9:126472493-126472515 CTATTTTAAAGGAGGAAAAAGGG - Intronic
1185511412 X:667703-667725 TTGTGAGGAAAGAGGAAATAGGG - Intergenic
1185937745 X:4277864-4277886 AAGAAAGGAAGGAGGAAAAAAGG - Intergenic
1186564138 X:10644364-10644386 CTGAGAGGAAGGAGGAATGAAGG - Intronic
1187815664 X:23228965-23228987 CTGTGAGGAAGAAGGCAAAGGGG + Intergenic
1188892655 X:35629717-35629739 CTGTTAGGGAGGTGGGAGAAGGG + Intergenic
1189138306 X:38573514-38573536 CTGTTAGTAATAGGGAAAAATGG - Intronic
1189230244 X:39446444-39446466 ATATTAGGAATCAGGAAAAAAGG + Intergenic
1189431089 X:40948066-40948088 CTGTTGAGAATGAGGAACAACGG + Intergenic
1190462883 X:50696119-50696141 CTTTGAGGAAGGAGGCAACATGG + Intronic
1191880824 X:65842443-65842465 CTGATAGGAAGGAGGAAGGAGGG - Intergenic
1194330172 X:92573129-92573151 GTGTTAGGAATGAGGAAAGTAGG + Intronic
1194527423 X:94994737-94994759 CTGTTTGGAAAGAAAAAAAATGG - Intergenic
1194965277 X:100281267-100281289 CTGTTGAGAAGGTGGAGAAAAGG - Intergenic
1195046882 X:101062572-101062594 GTCTAAGGAAGGAGAAAAAAAGG - Intergenic
1195670248 X:107463645-107463667 CTGATATGAAGGATGGAAAATGG + Intergenic
1196087133 X:111695737-111695759 GTTTTAGGAAGGAGAAATAAAGG - Intronic
1197604441 X:128568134-128568156 CTGTTAGGAAGTATAAAATAGGG - Intergenic
1199409026 X:147497985-147498007 CCTTTAGGAAGGAGACAAAAAGG + Intergenic
1199882843 X:151988636-151988658 CTCTTAGAAAGCAGGAAAGATGG + Intergenic
1200058229 X:153472544-153472566 CTCTCAGGAAGGGGGAAAGAAGG + Intronic
1201714276 Y:17027152-17027174 GGGAAAGGAAGGAGGAAAAAAGG - Intergenic
1201730200 Y:17193953-17193975 GAGTCAGGAAGGAGGAACAACGG + Intergenic