ID: 991366304

View in Genome Browser
Species Human (GRCh38)
Location 5:65871514-65871536
Sequence TTTTATGTCCATCAAGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991366304 Original CRISPR TTTTATGTCCATCAAGTGTA TGG (reversed) Intronic
905066067 1:35184206-35184228 TATAATGTCCCTCAAGTTTATGG - Exonic
909693166 1:78433670-78433692 TTTGATTTCCAGCAATTGTATGG + Intronic
917428962 1:174945574-174945596 TTTTTTTTCCTTCAAGTGTAAGG + Intronic
918545328 1:185676657-185676679 TTTTTTCTCCATCAAATGTCAGG + Intergenic
918915947 1:190637019-190637041 TTTTCTTTACATCAAGAGTAAGG + Intergenic
919155764 1:193764307-193764329 TTTTAAAACCATCAACTGTATGG + Intergenic
919360875 1:196592931-196592953 TTTTATTTCCATAAAATGTGGGG + Intronic
922293690 1:224230179-224230201 TTTTATTTCCCTGAAATGTATGG + Intronic
924671814 1:246135912-246135934 TATAATGTATATCAAGTGTAAGG + Intronic
924781848 1:247157114-247157136 TTTTATGTCTATTAAGAGAACGG + Exonic
1065298816 10:24302282-24302304 TTGGATGTCCATCATGGGTAAGG + Intronic
1065583700 10:27197152-27197174 TTTAATGTCCTTCAAGTTCAAGG + Exonic
1066343978 10:34564003-34564025 TTTTATTTGCATTAAGTGTCAGG - Intronic
1066605845 10:37169689-37169711 TTGCATGTCCATCAATTCTAAGG - Exonic
1066606628 10:37181481-37181503 TTGCATGTCCATCAATTCTAAGG - Intronic
1066607402 10:37193223-37193245 TTGCATGTCCATCAATTCTAAGG - Exonic
1068583883 10:58774706-58774728 TTTTATTTCCACCAAAAGTATGG + Intronic
1068807178 10:61210437-61210459 TTTTAGGACCCTCAAGTGTGGGG - Intergenic
1069273797 10:66564704-66564726 TTTTATGTCCTTCAAGGAAAAGG - Intronic
1070709433 10:78668210-78668232 TTTTATATCCAGCCAGGGTAAGG + Intergenic
1071128397 10:82362958-82362980 ATTTATGTTCAGCAATTGTAAGG + Intronic
1071267959 10:83981201-83981223 TTTAATTTCTATAAAGTGTATGG - Intergenic
1073751286 10:106530005-106530027 ATTTTTGTCCTTCAAGTGTCTGG + Intergenic
1073962151 10:108944678-108944700 TGTTATTTCCATCAGGTGTCAGG + Intergenic
1074850546 10:117436110-117436132 ATTTATCTCCTTCCAGTGTAAGG + Intergenic
1075125794 10:119697908-119697930 CTTCATATCCATCAAGTGTTGGG - Intergenic
1075764816 10:124885024-124885046 GTTTAAGGCCATCAAGTGAAGGG + Intergenic
1079631086 11:22676263-22676285 TTTTATCTCCATCAAGGAAAGGG + Intronic
1082577495 11:54826877-54826899 TTTTTTGTCCATTATGTGAATGG + Intergenic
1082753447 11:57047314-57047336 TTTTATTTCCATCAAGTTTTAGG - Intergenic
1086449422 11:86901222-86901244 TTTACTCTCCATCAGGTGTAGGG - Intronic
1087466083 11:98508106-98508128 CTTTCTCTCCATCAAGTGGAGGG + Intergenic
1090391363 11:126390561-126390583 TCATATGTCCACCAAGTGTTTGG + Intronic
1093846361 12:23976711-23976733 TTTTATATGCATGGAGTGTAAGG + Intergenic
1098080163 12:66775647-66775669 TTTTATCTTCATCAAATGAAAGG - Intronic
1100139529 12:91600031-91600053 TTTTATATCCTTCAAGTGTAAGG - Intergenic
1108261790 13:48665321-48665343 TGTTAGGTCCATCTGGTGTATGG + Intronic
1108920156 13:55662864-55662886 TTTTCAGTCCATCAAGTTTGTGG + Intergenic
1109957877 13:69591741-69591763 TTTTATGTCCAAATAGTGCAGGG + Intergenic
1110136985 13:72079706-72079728 TTCTGTGTTCATCAAGTGTCAGG - Intergenic
1110482463 13:75995739-75995761 TTTTCTGTCCATGATGTTTAGGG + Intergenic
1111146583 13:84189861-84189883 TTCTATTTCCATAAAATGTAAGG - Intergenic
1112545767 13:100368155-100368177 TTTTATGTCTCTGAAGTTTAAGG + Intronic
1113194909 13:107791670-107791692 TTTCATGTGCTTCAAATGTAAGG - Intronic
1116015384 14:39400941-39400963 TTTTTTGTCCATCATGTGAATGG - Intronic
1116688552 14:48074910-48074932 TTTTATATTCATCCAGTGTTTGG - Intergenic
1117568032 14:57016582-57016604 TTTTATTTCCATCATATCTATGG + Intergenic
1120839195 14:89068603-89068625 TTTGATGTCCATCATTCGTAGGG + Intergenic
1125130589 15:36279516-36279538 ATCTATGTCCATCAAGGGTGGGG + Intergenic
1125333208 15:38602384-38602406 TTTTATTTCCCTCAGGTTTATGG - Intergenic
1127827489 15:62717842-62717864 GTTTTTGTCCATTAAGTGGATGG + Intronic
1128627798 15:69229178-69229200 TATTATGTCTTTCCAGTGTATGG - Intronic
1134336738 16:13306809-13306831 TTTTATGTCACTCAATTCTAAGG - Intergenic
1138438424 16:57020095-57020117 TTTTATGTCGCTCAAATGTAGGG + Intronic
1139051752 16:63132050-63132072 TTTTATGTCATTCCACTGTATGG - Intergenic
1139083372 16:63553754-63553776 CTTTATGTACCTCAACTGTAAGG - Intergenic
1140028213 16:71311394-71311416 TTTCATGTCCCCTAAGTGTATGG + Intergenic
1140996157 16:80261479-80261501 GTTCATTTCCAGCAAGTGTAAGG - Intergenic
1143257286 17:5569972-5569994 TTTAATTTCCATGAATTGTATGG - Intronic
1143458364 17:7082813-7082835 TTTAATGTCCCTCAAGAATAGGG + Intergenic
1155920906 18:31601869-31601891 TCTTATGGGAATCAAGTGTAGGG + Intergenic
1156842231 18:41622831-41622853 TTTATTGTCCATAAAGTATATGG - Intergenic
1158327934 18:56330228-56330250 TGTTATGCCCATGAAGTCTATGG - Intergenic
1158337449 18:56428577-56428599 TTTAATTTCCATGAATTGTATGG - Intergenic
1162625400 19:11880874-11880896 TTTTATATCCAACAATTCTAGGG + Intronic
1165550275 19:36578013-36578035 TTTTCTATCCTTCAAGTGAAGGG + Intronic
1167955642 19:53061703-53061725 ATATATGCCCACCAAGTGTATGG + Intergenic
1168101080 19:54141324-54141346 TTTAAATTCCCTCAAGTGTAAGG + Intronic
925243197 2:2352716-2352738 TTTCATGTTCATCAAGTTCATGG + Intergenic
925572273 2:5325180-5325202 TTTCATGACCATCCAGTGGAAGG - Intergenic
928759266 2:34562046-34562068 TTTTGCCTCCATCAAGTGTATGG + Intergenic
929735494 2:44544012-44544034 ATTTTTGTCCAGAAAGTGTATGG - Intronic
931442326 2:62299012-62299034 TTTGGTGTCCATTATGTGTATGG - Intergenic
933267145 2:80193262-80193284 TTACATGTACATCAAGTGTTTGG + Intronic
933337424 2:80975972-80975994 TTTAATTACCATCAAGTGAAAGG + Intergenic
933399634 2:81778164-81778186 TTTTATAGCAATCAAGTGTTGGG + Intergenic
934899329 2:98145093-98145115 TTTAAAGTCCATTAAGTGTTAGG + Intronic
937446823 2:121965613-121965635 TTTTAGGTTCATTAAATGTAAGG - Intergenic
938699949 2:133867366-133867388 GTTTATGAACATGAAGTGTAAGG - Intergenic
940280555 2:151984674-151984696 GTTTATATTCATCAAGTATATGG - Intronic
942824582 2:180159793-180159815 ATTTATTTCCTTCAAGTTTATGG + Intergenic
943898571 2:193401974-193401996 TTTTTTTTTCATAAAGTGTAAGG + Intergenic
944293191 2:198031457-198031479 TTTTATATTTATCAATTGTATGG + Intronic
944965667 2:204929554-204929576 TTTTATTTCCAGCAACTGTAAGG + Intronic
1169248490 20:4042462-4042484 GTTTCTGTCCACCCAGTGTATGG - Intergenic
1171423828 20:25037137-25037159 TTTGTTGTCCATCAAGTACAAGG + Intronic
1173027017 20:39317332-39317354 TTCTAGGTCTATCAAGTGCATGG + Intergenic
1177725000 21:24955738-24955760 TTTTGTGTACATCCTGTGTAAGG - Intergenic
1178442115 21:32606964-32606986 TATTAAGTCAATCAAGTGTCTGG + Intronic
1184472962 22:44706199-44706221 CCCTATTTCCATCAAGTGTAAGG + Intronic
1184869203 22:47223706-47223728 TTTTATGTCTTTCAACTTTATGG + Intergenic
950745493 3:15084759-15084781 TATTATGTGCAAGAAGTGTATGG - Exonic
952667349 3:35922670-35922692 ATCTATGTCCATGAAGAGTAGGG + Intergenic
955364902 3:58302570-58302592 TTTTATGTCCCTGAAAGGTACGG - Intergenic
956433644 3:69211922-69211944 TTTTATGTCCAGACAATGTAAGG - Intronic
958842089 3:99218443-99218465 TTTTATTTCCTTCAACTGTCAGG - Intergenic
961853667 3:129847565-129847587 TCCCATATCCATCAAGTGTATGG - Intronic
962263441 3:133929070-133929092 TTATATGTCCTTGAAGGGTAGGG + Exonic
963446742 3:145420786-145420808 TTTTATGTCCCTCCACTTTAAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965635014 3:170771951-170771973 TCAGATGTCCATCAAGTTTAAGG + Intronic
969324450 4:6432961-6432983 TTTTCTGTTCATTAAGTGGAAGG - Intronic
970310058 4:14772888-14772910 TTTGATGTCCACCATGTGTCAGG + Intergenic
970475981 4:16423534-16423556 GTTTATGACCATTAAGTGAAGGG + Intergenic
970949484 4:21737061-21737083 GTTTCTGTCCCTCAAGTGAAAGG - Intronic
971122734 4:23722368-23722390 TATTATGTCTACTAAGTGTAGGG + Intergenic
971861739 4:32116111-32116133 TTTTATGTCCATGAAATTAAAGG - Intergenic
973144362 4:46805710-46805732 TTTTATTTTCATCCAGTTTATGG + Intronic
974195428 4:58568376-58568398 TTTTATCACCCTCAAGTCTAGGG + Intergenic
974937729 4:68428419-68428441 TTTTCTGTTTATCAAGAGTAAGG - Intergenic
979039472 4:115768905-115768927 TTATATGTCTAACAAGTCTATGG - Intergenic
980189984 4:129511786-129511808 ATTTGTGTCCATCCAGTGTTGGG + Intergenic
985202452 4:187497859-187497881 TTTTATGTACATGAAGTGAGGGG + Intergenic
985907205 5:2848981-2849003 TTTTATATACACCAAGGGTAGGG + Intergenic
986492035 5:8302965-8302987 TCTTAGTTCCATCAAGTGTAGGG + Intergenic
989148508 5:38273180-38273202 CTTTCTTTCCCTCAAGTGTATGG - Intronic
989844524 5:46124375-46124397 TTTTTTGTCGATTATGTGTATGG - Intergenic
989850469 5:46202693-46202715 TTTTTTGTCCATTATGTGAATGG + Intergenic
991366304 5:65871514-65871536 TTTTATGTCCATCAAGTGTATGG - Intronic
996361110 5:122648000-122648022 TTTTATCTGCAACAGGTGTATGG - Intergenic
998553319 5:143098824-143098846 TTGAATGTTCATCAAGTTTAAGG - Intronic
998890774 5:146743415-146743437 TTTTATGTACCACAAGTGAAGGG - Intronic
1002004140 5:176218101-176218123 ATTTATTTCCATCAACTTTAAGG - Intergenic
1002222235 5:177692539-177692561 ATTTATTTCCATCAACTTTAAGG + Intergenic
1003067572 6:2916826-2916848 TTTTATTTCCTTCAAGAGTAAGG - Intergenic
1003478508 6:6508385-6508407 TTTTGTGTCAATCAAATGAATGG - Intergenic
1004594839 6:17089484-17089506 TGTTAAGTCCTTCAAGTGGAAGG - Intergenic
1005008115 6:21310411-21310433 TTTTATGTCCATATACTATATGG + Intergenic
1006740759 6:36306865-36306887 TATTATGCACATCAAGTGTCTGG + Intronic
1009259310 6:61463697-61463719 GTTTATGTCCATTATGTGAATGG + Intergenic
1014748140 6:125223795-125223817 TTTAAAGTTCATCAAGTGTGAGG + Intronic
1014985601 6:128003511-128003533 TTTTAGATCTATCAAGTGTAAGG + Intronic
1014992578 6:128100457-128100479 TTTTATGTCCAGTAATTTTAAGG + Intronic
1017293847 6:152771934-152771956 TTTTATCTCAATGAAGTTTAAGG + Intergenic
1018561942 6:165109268-165109290 TATTAAGTCCATGAAGTTTAAGG - Intergenic
1021174708 7:17437809-17437831 TTTGATGTCCATTAAGAGGAAGG - Intergenic
1021737495 7:23654209-23654231 TTTTATATCCAGCAATTCTAGGG + Intergenic
1025595715 7:62922778-62922800 TTTTTTGTCCATTCTGTGTATGG + Intergenic
1027410198 7:77908235-77908257 GTTTATGTCCAGAAAGTCTAAGG + Intronic
1028304493 7:89246428-89246450 GTCTATGTCCATGAAGTGTGAGG - Intronic
1028764588 7:94538554-94538576 TTTTCTGTCAGTAAAGTGTAGGG + Intronic
1029825531 7:103188998-103189020 TTTTTTGTACATCAATTGTATGG - Intergenic
1029875967 7:103752114-103752136 TTTTGTTTTCATAAAGTGTATGG - Intronic
1032284326 7:130529413-130529435 TTTTATGTCCATCAACTTCCTGG - Intronic
1032617664 7:133492510-133492532 TTATCTTTCCCTCAAGTGTAAGG + Intronic
1033811963 7:145024957-145024979 TTTTCTTTCCATCAAGTCTGGGG + Intergenic
1035894847 8:3387808-3387830 TTTTATGTCCATGGATTGTTGGG - Intronic
1037577590 8:20222658-20222680 TTTTATTTTCAGCAAGTGTGAGG + Intronic
1037717710 8:21413732-21413754 CTCTATGTACACCAAGTGTAGGG + Intergenic
1041057666 8:54004047-54004069 TTTTATTTCCATAATGTCTAAGG - Intronic
1042301856 8:67291940-67291962 TTTTATCTACATCATTTGTATGG + Exonic
1044697295 8:94936166-94936188 TTTTATGTCCTTCAATCCTAGGG - Intronic
1046420644 8:113979576-113979598 TTCTAGGACCATCAATTGTAGGG - Intergenic
1050112029 9:2227121-2227143 TTTTATGTCTATCAAATGAAGGG + Intergenic
1054362719 9:64192589-64192611 GTTTATGTCCATTATGTGAATGG + Intergenic
1055046016 9:71924843-71924865 TATTATGTCATTCAAGTTTATGG - Intronic
1055566912 9:77578899-77578921 TTGGATGCCCATCAAGTGGAAGG - Intronic
1059879672 9:118676671-118676693 TTTTATGTGCATCAAGAAAATGG + Intergenic
1186731289 X:12413014-12413036 ATTAATGTCCATAAAGTGCATGG - Intronic
1187034462 X:15523144-15523166 TTTATTGGGCATCAAGTGTAGGG - Intronic
1187642002 X:21301884-21301906 TTTTTTTTTCATCAAGAGTATGG + Intergenic
1188754396 X:33943770-33943792 ATTATTGTCCATCAAATGTATGG - Intergenic
1188810397 X:34647233-34647255 TTTTATTGCCATCATGTTTAAGG - Intronic
1190084666 X:47384782-47384804 TTTTATGTCCTTCAATCATAAGG - Intronic
1190129009 X:47729885-47729907 TTTTAAGCCCATCAAGTTTGTGG + Intergenic
1192069377 X:67920706-67920728 TTTTATGTCCTGCAAGTTTCTGG - Intergenic
1195789864 X:108572222-108572244 TTTTATGTCCATCAAGCATCAGG + Intronic
1198891200 X:141398795-141398817 ATTTATATCCATCAAGGATATGG + Intergenic
1199412865 X:147545143-147545165 TTTTATTTCCATGCAGTCTAAGG - Intergenic
1200409346 Y:2846165-2846187 TTCTATGTCTAGCAAGTGCAAGG - Intronic
1201899115 Y:19028410-19028432 TTTAATGTCCATTACGTGTTTGG - Intergenic