ID: 991371080

View in Genome Browser
Species Human (GRCh38)
Location 5:65920614-65920636
Sequence TGGCACAATCGCTGGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991371073_991371080 16 Left 991371073 5:65920575-65920597 CCAGTAGTACACTAGTCCCAGTA No data
Right 991371080 5:65920614-65920636 TGGCACAATCGCTGGAGCCCAGG No data
991371077_991371080 -1 Left 991371077 5:65920592-65920614 CCAGTAACTCAGGAAGCTGAGGT No data
Right 991371080 5:65920614-65920636 TGGCACAATCGCTGGAGCCCAGG No data
991371075_991371080 0 Left 991371075 5:65920591-65920613 CCCAGTAACTCAGGAAGCTGAGG No data
Right 991371080 5:65920614-65920636 TGGCACAATCGCTGGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991371080 Original CRISPR TGGCACAATCGCTGGAGCCC AGG Intergenic
No off target data available for this crispr