ID: 991371683

View in Genome Browser
Species Human (GRCh38)
Location 5:65925977-65925999
Sequence CCCCGAGACGCGCAGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991371683_991371700 25 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371700 5:65926025-65926047 CAAGCAGGGCAGCGGAGGGACGG No data
991371683_991371701 28 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371701 5:65926028-65926050 GCAGGGCAGCGGAGGGACGGTGG No data
991371683_991371696 11 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371696 5:65926011-65926033 CTGGCGAAGGAGAACAAGCAGGG No data
991371683_991371699 21 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371699 5:65926021-65926043 AGAACAAGCAGGGCAGCGGAGGG No data
991371683_991371698 20 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371698 5:65926020-65926042 GAGAACAAGCAGGGCAGCGGAGG No data
991371683_991371690 -8 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371690 5:65925992-65926014 TCTCGGGGAGCCACCGCCGCTGG No data
991371683_991371691 -2 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371691 5:65925998-65926020 GGAGCCACCGCCGCTGGCGAAGG No data
991371683_991371695 10 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371695 5:65926010-65926032 GCTGGCGAAGGAGAACAAGCAGG No data
991371683_991371697 17 Left 991371683 5:65925977-65925999 CCCGCCCCCTGCGCGTCTCGGGG No data
Right 991371697 5:65926017-65926039 AAGGAGAACAAGCAGGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991371683 Original CRISPR CCCCGAGACGCGCAGGGGGC GGG (reversed) Intergenic
No off target data available for this crispr