ID: 991389799

View in Genome Browser
Species Human (GRCh38)
Location 5:66130200-66130222
Sequence TCCTCACTTTGGTTTCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991389799_991389805 -10 Left 991389799 5:66130200-66130222 CCAGGCCGAAACCAAAGTGAGGA No data
Right 991389805 5:66130213-66130235 AAAGTGAGGATGGGTACTCAGGG No data
991389799_991389806 5 Left 991389799 5:66130200-66130222 CCAGGCCGAAACCAAAGTGAGGA No data
Right 991389806 5:66130228-66130250 ACTCAGGGAAGTAAACTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991389799 Original CRISPR TCCTCACTTTGGTTTCGGCC TGG (reversed) Intergenic
No off target data available for this crispr