ID: 991395918

View in Genome Browser
Species Human (GRCh38)
Location 5:66205331-66205353
Sequence GATACACAAGGGCACACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991395918_991395924 20 Left 991395918 5:66205331-66205353 CCTGGTGTGTGCCCTTGTGTATC No data
Right 991395924 5:66205374-66205396 CACCAGTCATATTGGATTAAGGG 0: 34
1: 135
2: 310
3: 461
4: 546
991395918_991395923 19 Left 991395918 5:66205331-66205353 CCTGGTGTGTGCCCTTGTGTATC No data
Right 991395923 5:66205373-66205395 ACACCAGTCATATTGGATTAAGG 0: 235
1: 883
2: 1637
3: 2139
4: 1994
991395918_991395922 12 Left 991395918 5:66205331-66205353 CCTGGTGTGTGCCCTTGTGTATC No data
Right 991395922 5:66205366-66205388 TATAATGACACCAGTCATATTGG 0: 6
1: 246
2: 951
3: 1927
4: 2417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991395918 Original CRISPR GATACACAAGGGCACACACC AGG (reversed) Intergenic
No off target data available for this crispr