ID: 991396468

View in Genome Browser
Species Human (GRCh38)
Location 5:66209498-66209520
Sequence CACTGAAAAATTTTCTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991396468_991396478 12 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396478 5:66209533-66209555 CCTCAGGGCAAAATCCCAGCTGG No data
991396468_991396484 29 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396484 5:66209550-66209572 AGCTGGGGTGTGACATGCCAGGG No data
991396468_991396483 28 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396483 5:66209549-66209571 CAGCTGGGGTGTGACATGCCAGG No data
991396468_991396472 -4 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396472 5:66209517-66209539 AGTGGCTTCCCAGTGCCCTCAGG No data
991396468_991396480 14 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396480 5:66209535-66209557 TCAGGGCAAAATCCCAGCTGGGG No data
991396468_991396479 13 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396479 5:66209534-66209556 CTCAGGGCAAAATCCCAGCTGGG No data
991396468_991396473 -3 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396473 5:66209518-66209540 GTGGCTTCCCAGTGCCCTCAGGG No data
991396468_991396485 30 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991396468 Original CRISPR CACTGAAAAATTTTCTTCAG GGG (reversed) Intergenic
No off target data available for this crispr