ID: 991396474

View in Genome Browser
Species Human (GRCh38)
Location 5:66209525-66209547
Sequence GATTTTGCCCTGAGGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991396474_991396485 3 Left 991396474 5:66209525-66209547 CCCAGTGCCCTCAGGGCAAAATC No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data
991396474_991396484 2 Left 991396474 5:66209525-66209547 CCCAGTGCCCTCAGGGCAAAATC No data
Right 991396484 5:66209550-66209572 AGCTGGGGTGTGACATGCCAGGG No data
991396474_991396486 15 Left 991396474 5:66209525-66209547 CCCAGTGCCCTCAGGGCAAAATC No data
Right 991396486 5:66209563-66209585 CATGCCAGGGGCGATGACTAAGG No data
991396474_991396483 1 Left 991396474 5:66209525-66209547 CCCAGTGCCCTCAGGGCAAAATC No data
Right 991396483 5:66209549-66209571 CAGCTGGGGTGTGACATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991396474 Original CRISPR GATTTTGCCCTGAGGGCACT GGG (reversed) Intergenic
No off target data available for this crispr