ID: 991396485

View in Genome Browser
Species Human (GRCh38)
Location 5:66209551-66209573
Sequence GCTGGGGTGTGACATGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991396476_991396485 -4 Left 991396476 5:66209532-66209554 CCCTCAGGGCAAAATCCCAGCTG No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data
991396469_991396485 29 Left 991396469 5:66209499-66209521 CCCTGAAGAAAATTTTTCAGTGG No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data
991396475_991396485 2 Left 991396475 5:66209526-66209548 CCAGTGCCCTCAGGGCAAAATCC No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data
991396477_991396485 -5 Left 991396477 5:66209533-66209555 CCTCAGGGCAAAATCCCAGCTGG No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data
991396468_991396485 30 Left 991396468 5:66209498-66209520 CCCCTGAAGAAAATTTTTCAGTG No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data
991396474_991396485 3 Left 991396474 5:66209525-66209547 CCCAGTGCCCTCAGGGCAAAATC No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data
991396471_991396485 28 Left 991396471 5:66209500-66209522 CCTGAAGAAAATTTTTCAGTGGC No data
Right 991396485 5:66209551-66209573 GCTGGGGTGTGACATGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991396485 Original CRISPR GCTGGGGTGTGACATGCCAG GGG Intergenic
No off target data available for this crispr