ID: 991396486

View in Genome Browser
Species Human (GRCh38)
Location 5:66209563-66209585
Sequence CATGCCAGGGGCGATGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991396476_991396486 8 Left 991396476 5:66209532-66209554 CCCTCAGGGCAAAATCCCAGCTG No data
Right 991396486 5:66209563-66209585 CATGCCAGGGGCGATGACTAAGG No data
991396482_991396486 -8 Left 991396482 5:66209548-66209570 CCAGCTGGGGTGTGACATGCCAG No data
Right 991396486 5:66209563-66209585 CATGCCAGGGGCGATGACTAAGG No data
991396474_991396486 15 Left 991396474 5:66209525-66209547 CCCAGTGCCCTCAGGGCAAAATC No data
Right 991396486 5:66209563-66209585 CATGCCAGGGGCGATGACTAAGG No data
991396477_991396486 7 Left 991396477 5:66209533-66209555 CCTCAGGGCAAAATCCCAGCTGG No data
Right 991396486 5:66209563-66209585 CATGCCAGGGGCGATGACTAAGG No data
991396475_991396486 14 Left 991396475 5:66209526-66209548 CCAGTGCCCTCAGGGCAAAATCC No data
Right 991396486 5:66209563-66209585 CATGCCAGGGGCGATGACTAAGG No data
991396481_991396486 -7 Left 991396481 5:66209547-66209569 CCCAGCTGGGGTGTGACATGCCA No data
Right 991396486 5:66209563-66209585 CATGCCAGGGGCGATGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991396486 Original CRISPR CATGCCAGGGGCGATGACTA AGG Intergenic
No off target data available for this crispr