ID: 991399256

View in Genome Browser
Species Human (GRCh38)
Location 5:66236261-66236283
Sequence CTCTGGGAGGGGAGAAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991399243_991399256 4 Left 991399243 5:66236234-66236256 CCTGAACTTTCAGCCCTCCCCTC No data
Right 991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG No data
991399241_991399256 17 Left 991399241 5:66236221-66236243 CCCTGATTAGAAACCTGAACTTT No data
Right 991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG No data
991399247_991399256 -10 Left 991399247 5:66236248-66236270 CCTCCCCTCCATCCTCTGGGAGG No data
Right 991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG No data
991399246_991399256 -9 Left 991399246 5:66236247-66236269 CCCTCCCCTCCATCCTCTGGGAG No data
Right 991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG No data
991399240_991399256 21 Left 991399240 5:66236217-66236239 CCAGCCCTGATTAGAAACCTGAA No data
Right 991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG No data
991399239_991399256 22 Left 991399239 5:66236216-66236238 CCCAGCCCTGATTAGAAACCTGA No data
Right 991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG No data
991399242_991399256 16 Left 991399242 5:66236222-66236244 CCTGATTAGAAACCTGAACTTTC No data
Right 991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991399256 Original CRISPR CTCTGGGAGGGGAGAAGAGT TGG Intergenic
No off target data available for this crispr