ID: 991403821

View in Genome Browser
Species Human (GRCh38)
Location 5:66282013-66282035
Sequence GACATACTGGAGACTTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991403821_991403827 27 Left 991403821 5:66282013-66282035 CCTGTCCAAGTCTCCAGTATGTC No data
Right 991403827 5:66282063-66282085 ACTCATTTAAATGACCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991403821 Original CRISPR GACATACTGGAGACTTGGAC AGG (reversed) Intergenic
No off target data available for this crispr