ID: 991405153

View in Genome Browser
Species Human (GRCh38)
Location 5:66294117-66294139
Sequence ATCTCAAAGTCCTGGACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405153_991405162 26 Left 991405153 5:66294117-66294139 CCTTTAGTCCAGGACTTTGAGAT No data
Right 991405162 5:66294166-66294188 CGGGCTCCCGCTCAAGTCCTGGG No data
991405153_991405161 25 Left 991405153 5:66294117-66294139 CCTTTAGTCCAGGACTTTGAGAT No data
Right 991405161 5:66294165-66294187 ACGGGCTCCCGCTCAAGTCCTGG No data
991405153_991405156 6 Left 991405153 5:66294117-66294139 CCTTTAGTCCAGGACTTTGAGAT No data
Right 991405156 5:66294146-66294168 TCCAAGCAAAAAGCCTTCCACGG No data
991405153_991405158 7 Left 991405153 5:66294117-66294139 CCTTTAGTCCAGGACTTTGAGAT No data
Right 991405158 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405153 Original CRISPR ATCTCAAAGTCCTGGACTAA AGG (reversed) Intergenic
No off target data available for this crispr