ID: 991405154

View in Genome Browser
Species Human (GRCh38)
Location 5:66294125-66294147
Sequence GAGGAAACATCTCAAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405154_991405158 -1 Left 991405154 5:66294125-66294147 CCAGGACTTTGAGATGTTTCCTC No data
Right 991405158 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
991405154_991405156 -2 Left 991405154 5:66294125-66294147 CCAGGACTTTGAGATGTTTCCTC No data
Right 991405156 5:66294146-66294168 TCCAAGCAAAAAGCCTTCCACGG No data
991405154_991405161 17 Left 991405154 5:66294125-66294147 CCAGGACTTTGAGATGTTTCCTC No data
Right 991405161 5:66294165-66294187 ACGGGCTCCCGCTCAAGTCCTGG No data
991405154_991405162 18 Left 991405154 5:66294125-66294147 CCAGGACTTTGAGATGTTTCCTC No data
Right 991405162 5:66294166-66294188 CGGGCTCCCGCTCAAGTCCTGGG No data
991405154_991405165 25 Left 991405154 5:66294125-66294147 CCAGGACTTTGAGATGTTTCCTC No data
Right 991405165 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405154 Original CRISPR GAGGAAACATCTCAAAGTCC TGG (reversed) Intergenic
No off target data available for this crispr