ID: 991405157

View in Genome Browser
Species Human (GRCh38)
Location 5:66294147-66294169
Sequence CCCGTGGAAGGCTTTTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405157_991405168 16 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405168 5:66294186-66294208 GGGCCTGCGGTGCTGAGACAGGG No data
991405157_991405161 -5 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405161 5:66294165-66294187 ACGGGCTCCCGCTCAAGTCCTGG No data
991405157_991405165 3 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405165 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
991405157_991405170 22 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405157_991405162 -4 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405162 5:66294166-66294188 CGGGCTCCCGCTCAAGTCCTGGG No data
991405157_991405167 15 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405167 5:66294185-66294207 TGGGCCTGCGGTGCTGAGACAGG No data
991405157_991405171 30 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405157 Original CRISPR CCCGTGGAAGGCTTTTTGCT TGG (reversed) Intergenic
No off target data available for this crispr