ID: 991405159

View in Genome Browser
Species Human (GRCh38)
Location 5:66294159-66294181
Sequence CTTGAGCGGGAGCCCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405159_991405170 10 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405159_991405168 4 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405168 5:66294186-66294208 GGGCCTGCGGTGCTGAGACAGGG No data
991405159_991405167 3 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405167 5:66294185-66294207 TGGGCCTGCGGTGCTGAGACAGG No data
991405159_991405165 -9 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405165 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
991405159_991405171 18 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405159_991405172 26 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405159 Original CRISPR CTTGAGCGGGAGCCCGTGGA AGG (reversed) Intergenic