ID: 991405160

View in Genome Browser
Species Human (GRCh38)
Location 5:66294163-66294185
Sequence AGGACTTGAGCGGGAGCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405160_991405174 29 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405160_991405167 -1 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405167 5:66294185-66294207 TGGGCCTGCGGTGCTGAGACAGG No data
991405160_991405173 28 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405173 5:66294214-66294236 GCGTCTTGGTGCTCAGGCCTTGG No data
991405160_991405172 22 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405160_991405170 6 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405160_991405168 0 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405168 5:66294186-66294208 GGGCCTGCGGTGCTGAGACAGGG No data
991405160_991405175 30 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405175 5:66294216-66294238 GTCTTGGTGCTCAGGCCTTGGGG No data
991405160_991405171 14 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405160 Original CRISPR AGGACTTGAGCGGGAGCCCG TGG (reversed) Intergenic
No off target data available for this crispr