ID: 991405161

View in Genome Browser
Species Human (GRCh38)
Location 5:66294165-66294187
Sequence ACGGGCTCCCGCTCAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405154_991405161 17 Left 991405154 5:66294125-66294147 CCAGGACTTTGAGATGTTTCCTC No data
Right 991405161 5:66294165-66294187 ACGGGCTCCCGCTCAAGTCCTGG No data
991405153_991405161 25 Left 991405153 5:66294117-66294139 CCTTTAGTCCAGGACTTTGAGAT No data
Right 991405161 5:66294165-66294187 ACGGGCTCCCGCTCAAGTCCTGG No data
991405155_991405161 -2 Left 991405155 5:66294144-66294166 CCTCCAAGCAAAAAGCCTTCCAC No data
Right 991405161 5:66294165-66294187 ACGGGCTCCCGCTCAAGTCCTGG No data
991405157_991405161 -5 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405161 5:66294165-66294187 ACGGGCTCCCGCTCAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405161 Original CRISPR ACGGGCTCCCGCTCAAGTCC TGG Intergenic
No off target data available for this crispr