ID: 991405162

View in Genome Browser
Species Human (GRCh38)
Location 5:66294166-66294188
Sequence CGGGCTCCCGCTCAAGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405155_991405162 -1 Left 991405155 5:66294144-66294166 CCTCCAAGCAAAAAGCCTTCCAC No data
Right 991405162 5:66294166-66294188 CGGGCTCCCGCTCAAGTCCTGGG No data
991405154_991405162 18 Left 991405154 5:66294125-66294147 CCAGGACTTTGAGATGTTTCCTC No data
Right 991405162 5:66294166-66294188 CGGGCTCCCGCTCAAGTCCTGGG No data
991405153_991405162 26 Left 991405153 5:66294117-66294139 CCTTTAGTCCAGGACTTTGAGAT No data
Right 991405162 5:66294166-66294188 CGGGCTCCCGCTCAAGTCCTGGG No data
991405157_991405162 -4 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405162 5:66294166-66294188 CGGGCTCCCGCTCAAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405162 Original CRISPR CGGGCTCCCGCTCAAGTCCT GGG Intergenic
No off target data available for this crispr