ID: 991405163

View in Genome Browser
Species Human (GRCh38)
Location 5:66294172-66294194
Sequence CGCAGGCCCAGGACTTGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405163_991405167 -10 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405167 5:66294185-66294207 TGGGCCTGCGGTGCTGAGACAGG No data
991405163_991405172 13 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405163_991405171 5 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405163_991405177 29 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405177 5:66294224-66294246 GCTCAGGCCTTGGGGTTAGGAGG No data
991405163_991405175 21 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405175 5:66294216-66294238 GTCTTGGTGCTCAGGCCTTGGGG No data
991405163_991405168 -9 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405168 5:66294186-66294208 GGGCCTGCGGTGCTGAGACAGGG No data
991405163_991405170 -3 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405163_991405174 20 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405163_991405173 19 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405173 5:66294214-66294236 GCGTCTTGGTGCTCAGGCCTTGG No data
991405163_991405176 26 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405176 5:66294221-66294243 GGTGCTCAGGCCTTGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405163 Original CRISPR CGCAGGCCCAGGACTTGAGC GGG (reversed) Intergenic
No off target data available for this crispr