ID: 991405164

View in Genome Browser
Species Human (GRCh38)
Location 5:66294173-66294195
Sequence CCGCAGGCCCAGGACTTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405164_991405174 19 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405164_991405173 18 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405173 5:66294214-66294236 GCGTCTTGGTGCTCAGGCCTTGG No data
991405164_991405175 20 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405175 5:66294216-66294238 GTCTTGGTGCTCAGGCCTTGGGG No data
991405164_991405171 4 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405164_991405170 -4 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405164_991405172 12 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405164_991405177 28 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405177 5:66294224-66294246 GCTCAGGCCTTGGGGTTAGGAGG No data
991405164_991405176 25 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405176 5:66294221-66294243 GGTGCTCAGGCCTTGGGGTTAGG No data
991405164_991405168 -10 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405168 5:66294186-66294208 GGGCCTGCGGTGCTGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405164 Original CRISPR CCGCAGGCCCAGGACTTGAG CGG (reversed) Intergenic
No off target data available for this crispr