ID: 991405165

View in Genome Browser
Species Human (GRCh38)
Location 5:66294173-66294195
Sequence CCGCTCAAGTCCTGGGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405157_991405165 3 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405165 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
991405159_991405165 -9 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405165 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
991405154_991405165 25 Left 991405154 5:66294125-66294147 CCAGGACTTTGAGATGTTTCCTC No data
Right 991405165 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
991405155_991405165 6 Left 991405155 5:66294144-66294166 CCTCCAAGCAAAAAGCCTTCCAC No data
Right 991405165 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405165 Original CRISPR CCGCTCAAGTCCTGGGCCTG CGG Intergenic
No off target data available for this crispr