ID: 991405166

View in Genome Browser
Species Human (GRCh38)
Location 5:66294183-66294205
Sequence TGTCTCAGCACCGCAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405166_991405174 9 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405166_991405181 29 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405181 5:66294235-66294257 GGGGTTAGGAGGTAGGAGGAAGG No data
991405166_991405178 22 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405178 5:66294228-66294250 AGGCCTTGGGGTTAGGAGGTAGG No data
991405166_991405172 2 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405166_991405180 25 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405180 5:66294231-66294253 CCTTGGGGTTAGGAGGTAGGAGG No data
991405166_991405177 18 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405177 5:66294224-66294246 GCTCAGGCCTTGGGGTTAGGAGG No data
991405166_991405176 15 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405176 5:66294221-66294243 GGTGCTCAGGCCTTGGGGTTAGG No data
991405166_991405175 10 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405175 5:66294216-66294238 GTCTTGGTGCTCAGGCCTTGGGG No data
991405166_991405171 -6 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405166_991405173 8 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405173 5:66294214-66294236 GCGTCTTGGTGCTCAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405166 Original CRISPR TGTCTCAGCACCGCAGGCCC AGG (reversed) Intergenic