ID: 991405169

View in Genome Browser
Species Human (GRCh38)
Location 5:66294189-66294211
Sequence CTGCCCTGTCTCAGCACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405169_991405172 -4 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405169_991405175 4 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405175 5:66294216-66294238 GTCTTGGTGCTCAGGCCTTGGGG No data
991405169_991405178 16 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405178 5:66294228-66294250 AGGCCTTGGGGTTAGGAGGTAGG No data
991405169_991405174 3 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405169_991405181 23 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405181 5:66294235-66294257 GGGGTTAGGAGGTAGGAGGAAGG No data
991405169_991405180 19 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405180 5:66294231-66294253 CCTTGGGGTTAGGAGGTAGGAGG No data
991405169_991405176 9 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405176 5:66294221-66294243 GGTGCTCAGGCCTTGGGGTTAGG No data
991405169_991405173 2 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405173 5:66294214-66294236 GCGTCTTGGTGCTCAGGCCTTGG No data
991405169_991405177 12 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405177 5:66294224-66294246 GCTCAGGCCTTGGGGTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405169 Original CRISPR CTGCCCTGTCTCAGCACCGC AGG (reversed) Intergenic
No off target data available for this crispr