ID: 991405170

View in Genome Browser
Species Human (GRCh38)
Location 5:66294192-66294214
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405159_991405170 10 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405155_991405170 25 Left 991405155 5:66294144-66294166 CCTCCAAGCAAAAAGCCTTCCAC No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405160_991405170 6 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405163_991405170 -3 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405164_991405170 -4 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data
991405157_991405170 22 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405170 5:66294192-66294214 GCGGTGCTGAGACAGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr