ID: 991405171

View in Genome Browser
Species Human (GRCh38)
Location 5:66294200-66294222
Sequence GAGACAGGGCAGTGGCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405160_991405171 14 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405166_991405171 -6 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405163_991405171 5 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405157_991405171 30 Left 991405157 5:66294147-66294169 CCAAGCAAAAAGCCTTCCACGGG No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405159_991405171 18 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data
991405164_991405171 4 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405171 5:66294200-66294222 GAGACAGGGCAGTGGCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405171 Original CRISPR GAGACAGGGCAGTGGCGTCT TGG Intergenic
No off target data available for this crispr