ID: 991405172

View in Genome Browser
Species Human (GRCh38)
Location 5:66294208-66294230
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405160_991405172 22 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405164_991405172 12 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405159_991405172 26 Left 991405159 5:66294159-66294181 CCTTCCACGGGCTCCCGCTCAAG No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405163_991405172 13 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405169_991405172 -4 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG 0: 1
1: 0
2: 4
3: 13
4: 207
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data
991405166_991405172 2 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405172 5:66294208-66294230 GCAGTGGCGTCTTGGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type