ID: 991405174

View in Genome Browser
Species Human (GRCh38)
Location 5:66294215-66294237
Sequence CGTCTTGGTGCTCAGGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405169_991405174 3 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405163_991405174 20 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405160_991405174 29 Left 991405160 5:66294163-66294185 CCACGGGCTCCCGCTCAAGTCCT No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405164_991405174 19 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data
991405166_991405174 9 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405174 5:66294215-66294237 CGTCTTGGTGCTCAGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405174 Original CRISPR CGTCTTGGTGCTCAGGCCTT GGG Intergenic
No off target data available for this crispr