ID: 991405176

View in Genome Browser
Species Human (GRCh38)
Location 5:66294221-66294243
Sequence GGTGCTCAGGCCTTGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405163_991405176 26 Left 991405163 5:66294172-66294194 CCCGCTCAAGTCCTGGGCCTGCG No data
Right 991405176 5:66294221-66294243 GGTGCTCAGGCCTTGGGGTTAGG No data
991405166_991405176 15 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405176 5:66294221-66294243 GGTGCTCAGGCCTTGGGGTTAGG No data
991405164_991405176 25 Left 991405164 5:66294173-66294195 CCGCTCAAGTCCTGGGCCTGCGG No data
Right 991405176 5:66294221-66294243 GGTGCTCAGGCCTTGGGGTTAGG No data
991405169_991405176 9 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405176 5:66294221-66294243 GGTGCTCAGGCCTTGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405176 Original CRISPR GGTGCTCAGGCCTTGGGGTT AGG Intergenic
No off target data available for this crispr