ID: 991405181

View in Genome Browser
Species Human (GRCh38)
Location 5:66294235-66294257
Sequence GGGGTTAGGAGGTAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991405169_991405181 23 Left 991405169 5:66294189-66294211 CCTGCGGTGCTGAGACAGGGCAG No data
Right 991405181 5:66294235-66294257 GGGGTTAGGAGGTAGGAGGAAGG No data
991405166_991405181 29 Left 991405166 5:66294183-66294205 CCTGGGCCTGCGGTGCTGAGACA No data
Right 991405181 5:66294235-66294257 GGGGTTAGGAGGTAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991405181 Original CRISPR GGGGTTAGGAGGTAGGAGGA AGG Intergenic
No off target data available for this crispr