ID: 991406522

View in Genome Browser
Species Human (GRCh38)
Location 5:66305686-66305708
Sequence ACTGCCTCTTATTTCTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991406522_991406526 3 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406526 5:66305712-66305734 AAGCTGAACTGAGGGACAGAGGG No data
991406522_991406525 2 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406525 5:66305711-66305733 GAAGCTGAACTGAGGGACAGAGG No data
991406522_991406527 8 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406527 5:66305717-66305739 GAACTGAGGGACAGAGGGACTGG No data
991406522_991406529 17 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406529 5:66305726-66305748 GACAGAGGGACTGGAGCAGAGGG No data
991406522_991406524 -5 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406524 5:66305704-66305726 GCAGTGAGAAGCTGAACTGAGGG No data
991406522_991406530 18 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406530 5:66305727-66305749 ACAGAGGGACTGGAGCAGAGGGG No data
991406522_991406523 -6 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406523 5:66305703-66305725 GGCAGTGAGAAGCTGAACTGAGG No data
991406522_991406531 30 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406531 5:66305739-66305761 GAGCAGAGGGGACAAATCCAAGG No data
991406522_991406528 16 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406528 5:66305725-66305747 GGACAGAGGGACTGGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991406522 Original CRISPR ACTGCCTCTTATTTCTCACT TGG (reversed) Intergenic
No off target data available for this crispr