ID: 991406526

View in Genome Browser
Species Human (GRCh38)
Location 5:66305712-66305734
Sequence AAGCTGAACTGAGGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991406522_991406526 3 Left 991406522 5:66305686-66305708 CCAAGTGAGAAATAAGAGGCAGT No data
Right 991406526 5:66305712-66305734 AAGCTGAACTGAGGGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991406526 Original CRISPR AAGCTGAACTGAGGGACAGA GGG Intergenic
No off target data available for this crispr